MCP Danish Cancer Society
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/mcp.T100002-MCP200 on November 27, 2001.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
T100002-MCP200v1
1/2/99    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Glossary
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Molecular & Cellular Proteomics 1:99-103, 2002.
© 2002 by The American Society for Biochemistry and Molecular Biology, Inc.


Technology

Combinatorial Selection of RNA Ligands for Complex Cellular Targets

The RNA Liagands-Based Proteomics*

Huicheng Tian{ddagger}

From the Department of Genetics, Center for Genetic and Cellular Therapies, Duke University, Durham, North Carolina 27710


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study explores the selection of high affinity RNA ligands for the complex cellular targets present in crude HeLa nuclear extract through directed evolution and deconvolution. RNA ligands for the mixed nuclear targets were selected from around 6 x 1014 RNA sequences through an iterated enrichment process. RNA ligands for various gene products of the extract were simultaneously selected and were shown to specifically interact with their target molecules. The target molecules were isolated from the nuclear extract by affinity chromatography using columns tagged with the RNA ligands, resolved on two-dimensional gels, and identified by mass spectrometry. These RNA ligands may be useful in characterizing novel functions of cellular proteins and modulating complex molecular events.


Native ligand molecules of cells, such as thyroid hormone and steroids, have been used to establish the identity and function of their nuclear receptors (1). These ligand-receptor complexes specifically interact with the transcription apparatus to regulate the expression of target genes (1,2). However, this approach applies only to a small number of cellular targets, because a majority of cellular proteins do not have high affinity or stable native ligands. Recently it has been established that single-stranded nucleic acid molecules with short randomized sequences can provide enormous sequence diversity and folding moieties with affinity for various cellular proteins and other molecules (35). Through an iterated enrichment process (SELEX (systematic evolution of ligands by exponential enrichment)), particular ligand molecules can be selected based on their affinity for targets or other activities. Many of these ligands act as antagonists of their cellular targets (58).

In selecting RNA ligands for various targets, purified proteins are commonly used in a mixture of simple components. Although there have been attempts to select RNA ligands for complex proteins, RNA pools tend to be quickly reduced to bind only one or a few predominant proteins after the initial rounds of selection (reviewed in Ref. 9). This present study reports that high affinity RNA ligands for numerous targets present in a crude cellular extract have been simultaneously selected and that specific cellular targets have been identified using the RNA ligands.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA Templates, RNA Library, and HeLa Nuclear Extract—
The initial pool of DNA templates for RNA molecules was constructed by annealing two chemically synthesized overlapping DNA oligos, template oligo containing a section of 40 random nt1 and constant flanking sequences on either side (5'-GAGGAAGAGGGATGGGN40CATAACCCAGAGGTCGAT-3') and complementary 5'-DNA oligo (5'PR, 5'GGGGGAATTCTAATACGACTCACTATAGGGAGAGAGGAAGAGGGATGGG3'), which were converted into dsDNA by DNA polymerase I (Promega). In later rounds, the DNA templates were regenerated from RNA molecules by reverse transcriptase (Roche Molecular Biochemicals) and PCR with primers 5'PR and 3'PR (5'-GGGGGGATCCAGTACTATCGACCTCTGGGTTATG-3'). For reverse transcriptase PCR, the first DNA strand was synthesized from the selected RNA molecules and 3'PR using a reverse transcription kit (Roche Molecular Biochemicals), followed by PCR with both 3'PR and 5'PR using a PCR kit (Invitrogen). In separate experiments, the RNA 43 mutants (RNA 43A and RNA 43B) were generated from dsDNA templates obtained through PCR with primers 5'PR and 3'PR and synthetic DNA oligos (43A, 5'-GAGGAAGAGGGATGGGCCAATAAACATCAGTACATCACATAACCCAGAGGTCGAT-3' and 43B, 5'-GAGGAAGAGGGATGGGACTAAAGGTAAGTATAACATAACCCAGAGGTCGAT-3', respectively). The RNA molecules were synthesized by T7 RNA polymerase (Roche Molecular Biochemicals) in vitro and purified on a 10% polyacrylamide/7 M urea gel after the DNA templates were removed by DNase I digestion (Promega). HeLa nuclear extract was prepared as described previously (10).

Selection Scheme, Gel Mobility Shift Assay, Cloning, and Autoradiography—
In the first round, HeLa nuclear extract (200 µg), RNA (10 nmol, transcribed from dsDNA templates of around 6 x 1014 different sequences), and tRNA (1 mg) were combined in a volume of 1 ml in incubation buffer (20 m M HEPES, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 20% glycerol). In later rounds, nuclear proteins (20–25 µg), RNA (~1 nmol), and tRNA (20 µg) were incubated in a volume of 100 µl. RNA molecules were selected through a combination of RNase protection assay using the endogenous RNase activities present in the nuclear extract to eliminate the unbound RNA (rounds 1–8) and gel mobility shift assay to isolate the RNA associated with other molecules present in the extract (rounds 9–14). For the gel mobility shift assay, the mixture of 32P-labeled RNA, HeLa nuclear proteins (25 µg), and tRNA (20 µg) in a volume of 100 µl was incubated at 37 °C for a variable time and loaded on a 5% non-denaturing polyacrylamide gel (acrylamide:bisacrylamide, 80:1). Radiolabeled RNA in mobility shift complexes was excised and eluted from gel by shaking in sodium acetate (0.3 M), extracted by phenol, precipitated by ethanol, and converted into dsDNA template through reverse transcriptase PCR for the next round of selection. For cloning, the dsDNA templates from the fourteenth round were ligated into pUC19 vector (New England Biolabs) through EcoRI and BamHI restriction sites, which were used to transform DH5{alpha} Escherichia coli competent cells (Invitrogen). For imaging, gels were dried, and autoradiographs were scanned with a Storm 840 PhosphorImager (Molecular Dynamics).

RNA-based Affinity Chromatography, 2D Gel Electrophoresis, and Western Blot—
Equal amounts of HeLa nuclear proteins were loaded onto columns containing streptavidin-agarose beads (Amersham Biosciences, Inc.) without or tagged with RNA ligands. The ligands were attached to the beads through annealing to a biotinylated 2'-O-methyl-RNA oligonucleotide (5'-biotin-AGUACUAUCGACCUCUGGGUUAUG-3') that is complementary to a part of the 3'-constant sequence of the RNA ligands. After washing, the bound proteins were eluted with a DNA oligonucleotide (3'PR) complementary to the entire 3'-constant sequence of the RNA ligands. For Western blot analysis, the eluted protein samples were boiled in 1x SDS loading buffer (50 m M Tris-Cl, 100 mM dithiothreitol, 2% SDS, 0.1% bromphenol blue, 10% glycerol) before being resolved on a 10% polyacrylamide/SDS gel and electrically transferred onto a nitrocellulose membrane (Schleicher & Schuell). The membrane was then immunoblotted with an anti-U1 70k subunit monoclonal antibody (N-20; Santa Cruz Biotechnology) after being incubated with 5% blocking reagent for Western blot analysis by ECL (Amersham Biosciences, Inc.). For 2D gel electrophoresis, the eluted proteins were concentrated to a final volume of 50 µl using microspin columns (Millipore). Isoelectric focusing was carried out in pH 3.5–10 gradient ampholine tube gels, which were placed on 10% polyacrylamide/SDS gels during the second dimension electrophoresis. The gels were then stained with silver (11) and dried between sheets of cellophane. Unique and highly enriched proteins were found by comparing 2D gels of the protein samples isolated with different RNA ligands and were identified by matrix-assisted laser desorption/ionization mass spectrometry (Protein Chemistry Core Facility at Columbia University).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Simultaneous Enrichment of RNA Ligands for Complex Nuclear Targets—
The current strategy of selection for RNA ligands has been mostly limited to purified targets, in which the binding affinity of RNA ligands for target molecules can be easily monitored with simple assays and the selection "pressure" can be easily regulated by changing conditions for binding. For complex targets such as the HeLa nuclear extract the presence of genomic DNA, cellular RNA, and certain abundant nucleic acid-binding proteins (such as histones) may complicate selection. Therefore, the binding conditions cannot be easily adjusted for one or a few particular targets while driving the gross selection for a maximum number of targets. In the early experiments, the unbound RNA molecules were found to be rapidly degraded in the HeLa nuclear extract whereas the bound RNA molecules were found to remain intact (data not shown). In the first eight rounds of selection, the RNase protection assay was employed to eliminate the free RNA molecules and to enrich the bound ones. For each round, RNA/protein binding was assayed by gel mobility shift assay in a wide range of nuclear protein concentrations and with a variable time of incubation in the presence of non-competitor RNA (tRNA). The integrity of RNA ligands was detected by denaturing gel electrophoresis. Particular protein concentrations and the time of incubation were chosen at which 80–90% of the input RNA molecules were largely degraded whereas the remaining 10–20% of the input RNA molecules were bound and intact. In the first round, a total of 200 µg of HeLa nuclear extract and 10 nmol of RNA were combined in a volume of 1 ml. In later rounds, 20–25 µg of nuclear proteins and roughly 1 nmol of RNA were used in a volume of 100 µl. However, as selection progressed the RNA pool became more and more resistant to degradation, which required higher protein concentration or longer incubation time to reduce the input RNA. From the ninth to fourteenth rounds, gel mobility shift assay was used to more efficiently isolate the bound RNA molecules from each pool. As shown in Fig. 1, the selection had enriched RNA ligands to numerous targets, as evidenced by the increase of the RNA species present in the mobility shift complexes in round 14 compared with the counterparts of the starting pool.



View larger version (78K):
[in this window]
[in a new window]
 
FIG. 1. Gel mobility shift assay of pool 1 and pool 14 RNA. The 32P-labeled pool 1 and pool 14 RNA were incubated with increasing amounts of HeLa nuclear extract (NE) proteins (0–5 µg) and tRNA (10 µg) in a total volume of 20 µl at 30 °C for 30 min. The samples were then resolved on a 5% non-denaturing polyacrylamide gel. The RNA molecules present in mobility shift complexes (marked on the right) were excised and eluted for reverse transcriptase PCR in rounds 9–14.

 
Specific Interaction of RNA Ligands and Nuclear Proteins—
Among 60 RNA ligands isolated from pool 14, no identical 40-nt sequences in the randomized region were found (Fig.2 ). However, four (RNAs 9, 13, 15, and 43) contain an 11-nt consensus sequence at variable positions, which is identical to the 5'-splice site of eukaryotic pre-mRNAs (12). To characterize individual RNA ligands and their specific cellular targets, purified RNA molecules were used either to detect the effect on nuclear functions (e.g. transcription and RNA splicing) or to directly analyze for RNA-protein interactions by various biochemistry methods. To determine whether the RNA ligands interact with similar or different gene products, gel mobility shift and UV cross-linking assays were performed using 32P-labeled RNA ligands as probes. Among a number of RNA ligands, RNAs 5 and 43 had displayed distinct RNA-protein interactions (data not shown). To identify the molecules that specifically interact with the RNA ligands, protein samples eluted from RNA 43- and RNA 5-tagged affinity columns were resolved on 2D gels, and unique protein spots shown by superimposing the two gel images were isolated for identification by mass spectrometry. As shown in Fig. 3A, each of the 2D gels showed unique proteins specifically isolated by RNA 43 (e.g. a, multiple isoforms of the same protein of 66 kDa) and by RNA 5 ligands (b, proteins of 96 kDa). Through mass spectrometry, one of the unique proteins isolated by RNA 43 was identified as hnRNP L. hnRNP L has been shown to specifically recognize sequence at the 3'-UTR of several mRNAs, including the glucose transporter 1 and human vascular endothelial growth factor (hVEGF) mRNA (14, 15). Within the random sequence region, RNA 43 contains a sequence highly homologous (62%) to the hnRNP L binding motif found in hVEGF mRNA (Fig. 3B). Therefore, it appears that hnRNP L has been isolated through direct interaction with RNA 43. In addition, this study also shows that certain isoforms of hnRNP L more specifically interact with the motif of RNA 43 (Fig. 3A).



View larger version (82K):
[in this window]
[in a new window]
 
FIG. 2. Partial list of sequences within the random region of RNA ligands isolated from pool 14. Among 60 RNA ligands, four (RNAs 9, 13, 15, and 43) contain an 11-nt consensus sequence at variable positions (underlined), which is identical to the 5'-splice site of eukaryotic pre-mRNAs.

 


View larger version (43K):
[in this window]
[in a new window]
 
FIG. 3. A, two-dimensional gel electrophoresis of the proteins isolated through affinity chromatography using columns of agarose beads tagged with RNAs 5 or 43. Equal amounts of HeLa nuclear proteins were loaded onto columns containing streptavidin-agarose beads tagged with RNAs 5 or 43. The ligands were affixed to the beads by annealing them to a biotinylated 2'-O-methyl-RNA oligonucleotide (5'-biotin-AGUACUAUCGACCUCUGGGUUAUG-3') that is complementary to the 3'-constant sequence of the ligands. The bound proteins were eluted with a DNA oligonucleotide (5'-GGGGGGATCCAGTACTATCGACCTCTGGGTTATG-3') complementary to the entire 3'-constant sequence of the RNA ligands. Isoelectric focusing was carried out in pH 3.5–10 gradient ampholine tube gels (left to right), which were placed on a 10% polyacrylamide/SDS gel during the second dimension electrophoresis. The gels were then stained with silver and dried between sheets of cellophane. Unique and highly enriched proteins were identified by comparing the 2D gel images. Only the equivalent parts of the gels containing specifically isolated proteins are shown. a, isomers of hnRNP L. b, proteins specifically isolated by RNA 5. Protein molecular mass (MM) markers are on the right. B, sequence homology between RNA 43 and hnRNP L binding motifs found in the hVEGF 3'-UTR mRNA. For RNA 43, motif 1 is identical to the eukaryotic 5'-splice site, and motif 2 is 62% homologous to the hnRNP L binding sequence found in the 3'-UTR of hVEGF mRNA. C, Western blot analysis of the affinity-purified nuclear proteins with anti-U1 70k. As described for A, equal amounts of HeLa nuclear proteins were used for affinity chromatography with columns containing streptavidin-agarose beads without RNA ligands (Beads) or tagged with RNAs 5 and 43 or the RNA 43 mutants (RNA 43A and RNA 43B), which lack either the 5'-splice site (underlined) or the hnRNP L binding motif (bold). Only sequences in the random region are shown (bottom) whereas the flanking sequences are the same in all RNA ligands. Western blot analysis was conducted using a monoclonal antibody specific for U1 70k.

 
Adjacent to the hnRNP L binding motif, RNA 43 also contains an 11-nt sequence resembling the 5'-splice site of eukaryotic pre-mRNAs (see Fig. 2 and Fig. 3B), which is complementary to the 5'-end of U1 RNA except its cap structure (5'-m3GpppAmUmAC{Psi}{Psi}ACCU-3'; {Psi} = pseudouridine, m = methyl group, m3G = trimethyl guanosine cap) (13). To determine whether U1 snRNP had been specifically isolated by RNA 43, the eluted proteins from the RNA affinity columns were analyzed by Western blot with an antibody specific for the 70k subunit of U1 snRNP. The U1 70k was detected only in proteins (samples) eluted from RNA 43 and a mutant (RNA 43B) that contains the 5'-splice site, and a lower amount of U1 70k was detected in the sample from another mutant (RNA 43A) that contains the hnRNP L binding motif but lacks the 5'-splice site, while U1 70k was non-detectable in the sample from RNA 5 or beads alone (Fig. 3C). This indicates that the selected RNA ligands have isolated cellular RNA-protein complexes (U1 snRNP) through RNA-RNA interactions and that a portion of the cellular U1 snRNP pool is associated with hnRNP L either through direct interaction or through other factors. It has been found that U1 snRNP associates with partially purified hnRNPs through protein-protein interactions in the absence of splice sites (16). In recent years, increasing number of studies have shown that RNA splicing factors and members of the hnRNP family interact with each other and with the transcription machinery of RNA polymerase II (pol II) in the coordinated events of transcription and RNA processing (1726). The results of this study also suggest the complex interplay of these events.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In general, the functions of cellular proteins have been studied by mutagenesis using genetic screen in vivo or fractionation and complementation of cellular extracts in vitro. However, the in vivo mutagenesis approach is often hampered by more frequent mutations at particular "hot spots" or by the lack of feasible screening methods for certain phenotypes. The cellular fractionation approach is often obscured by impurity or low abundance of proteins of interest and is usually limited to the study of one or a few factors because of the difficulty of isolating complex activities in a small number of fractions from crude cellular extracts. More recently, RNA ligands with an affinity for various molecules even without putative nucleic acid binding sites have been selected from large pools of diverse RNA sequences (3, 4). Herein, this study shows that RNA ligands can be simultaneously selected against various targets present in crude cellular extracts and used to identify factors specifically recognized by the ligands and that these ligands may prove useful in identifying novel functions of cellular proteins.

For a complex mixture of molecules such as the HeLa nuclear extract, numerous molecules are potential RNA binding targets, including the genomic DNA and cellular RNA. The RNase protection assay used in the selection of this study may have largely eliminated those RNA molecules that bind to the genomic DNA and to other cellular RNA molecules because of the presence of intensive RNase activities in the extract. The experimental procedures used in this study preserved the native conformation of various gene products throughout selection unlike other methods such as binding on nitrocellulose filters or other solid support. This method may have general use in selecting RNA ligands for various targets under complex cellular environments. Although RNA ligands have been commonly selected for purified proteins, the ligands are often not applicable to cellular conditions or useful for analyzing complex molecular interactions. This present study has established that RNA ligands selected for complex protein targets can be used to purify and identify their target molecules from crude cellular extracts. This approach offers certain advantages over other methods. First, the RNA ligand-based affinity chromatography eliminates the need for the fusion of cellular proteins with other sequence tags such as glutathione S-transferase and histidines, which may cause the misfolding of proteins. Second, antibodies raised against cellular proteins may not be useful for immunoaffinity purification because of the inaccessibility of epitopes under cellular environments (27) or denaturation of proteins by harsh elution reagents. In comparison, RNA ligands can be selected for domains on or near the surface of protein complexes in native conformation and can directly bind to protein targets in cellular extracts. Third, current chromatography methods can only fractionate single components from relatively large amounts of cellular samples and have not allowed the simultaneous characterization of numerous factors involved in complex molecular events such as the initiation of pol II transcription and splicing of eukaryotic pre-mRNAs. This present study shows that RNA ligands for numerous cellular targets may be obtained in the same selection and used to isolate specific cellular targets.

In recent years, numerous studies have shown that RNA processing factors, members of the hnRNP family, and transcription apparatus form a complex network in the coordinated events of transcription and RNA processing. It has been found that hnRNPs directly interact with basal and cell-specific transcription factors and that RNA splicing factors associate with pol II in the absence of transcription (1721). It has also been shown that hnRNPs either bind to pre-mRNA or directly interact with snRNPs (16, 25) to affect splice site selection during RNA splicing (see Ref. 26; reviewed in Ref. 12). Some RNA ligands selected in this study (e.g. RNA 43) are recognized by members of the hnRNP family, such as hnRNP L, which has been shown to bind pre-mRNA (28). The close positioning of the binding sites for U1 snRNP and hnRNP L found within the same RNA ligand (RNA 43) also suggests that U1 snRNP and hnRNP L may be functionally linked. Affinity chromatography using the selected ligands, as well as the mutated RNA sequences lacking either the 5'-splice site (RNA 43A) or the hnRNP L binding motif (RNA 43B), confirms that a portion of the U1 snRNP pool is indeed associated with hnRNP L in HeLa nuclear extract (Fig. 3C). The selected RNA ligands are now being screened for an effect on RNA splicing and pol II transcription, as well as other activities. The RNA ligands are directly added to the function assays in vitro or integrated into other RNA substrates (e.g. see Ref. 29) or expressed in cells via plasmids. The effective ligands will be used for affinity chromatography to characterize their specific cellular targets. As a result, novel functions of the target molecules may be discovered.


    ACKNOWLEDGMENTS
 
I am grateful to Drs. Ryszard Kole, Michael 2Dahmus, and Arno Greenleaf for helpful discussions and William Burk for critically reading the manuscript.


    FOOTNOTES
 
Received, September 4, 2001, and in revised form, November 26, 2001.

1 The abbreviations used are: nt, nucleotide(s); hnRNP, heterogeneous nuclear ribonucleoprotein particle; hVEGF, human vascular endothelial growth factor; snRNP, small nuclear ribonucleoprotein particle; UTR, untranslated region; ds, double-stranded; 2D, two-dimensional; pol II, polymerase II. Back

* This work was supported in part by National Institutes of Health Grant 0911121A1. The cost of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1743 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Fax: 919-942-2345; E-mail: htian{at}alumnidirector.com.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) The nuclear receptor superfamily: the second decade. Cell 83, 835–839[CrossRef][Medline]

  2. Xu, L., Glass, C. K., and Rosenfeld, M. G. (1999) Coactivator and corepressor complexes in nuclear receptor function. Curr. Opin. Genet. Dev. 9, 140–147[CrossRef][Medline]

  3. Ellington, A. D., and Szostak, J. W. (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818–822[CrossRef][Medline]

  4. Tuerk, C., and Gold, L. (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505–510[Abstract/Free Full Text]

  5. Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H., and Toole, J. J. (1992) Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564–566[CrossRef][Medline]

  6. Jellinek, D., Green, L. S., Bell, C., and Janjic, N. (1994) Inhibition of receptor binding by high affinity RNA ligands to vascular endothelial growth factor. Biochemistry 33, 10450–10456

  7. Pagratis, N. C., Bell, C., Chang, Y., Jennings, S., Fitzwater, T., Jellinek, D., and Dang, C. (1997) Potent 2'-amino, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat. Biotech. 15, 68–73[CrossRef][Medline]

  8. Pan, W., Craven, R. C., Qiu, Q., Wilson, C. B., Wills, J. W., Golovine, S., and Wang, J.-F. (1995) Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proc. Natl. Acad. Sci. U. S. A. 92, 11509–11513[Abstract/Free Full Text]

  9. Morris, K. N., Jensen, K. B., Julin, C. M., Weil, M., and Gold, L. (1998) High affinity ligands from in vitro selection: complex targets. Proc. Natl. Acad. Sci. U. S. A. 95, 2902–2907[Abstract/Free Full Text]

  10. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475–1489[Abstract/Free Full Text]

  11. O’Connell, K. L., and Stults, J. T. (1997) Identification of mouse liver proteins on two-dimensional electrophoresis gels by matrix-assisted laser desorption/ionization mass spectrometry of in situ enzymatic digests. Electrophoresis 18, 349–359[CrossRef][Medline]

  12. Moore, M. J., Query, C. C., and Sharp, P. A. (1993) in The RNA World (Gesteland, R. F. and Atkins, J. F., eds) 1st Ed., pp. 303–357, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

  13. Reddy, R., and Busch, H. (1988) in Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles (Birnstiel, M. L., ed) pp. 1–37, Springer-Verlag, Berlin

  14. Hamilton, B. J., Nichols, R. C., Tsukamoto, H., Boado, R., Pardridge, W. M., and Rigby, W. F. C. (1999) hnRNP A2 and hnRNP L bind the 3'UTR of glucose transporter 1 mRNA and exist as a complex in vivo. Biochem. Biophys. Res. Commun. 261, 646–651[CrossRef][Medline]

  15. Shih, S.-C., and Claffey, K. P. (1999) Regulation of human vascular endothelial growth factor mRNA stability in hypoxia by heterogeneous nuclear ribonucleoprotein L. J. Biol. Chem. 274, 1359–1365[Abstract/Free Full Text]

  16. Wilk, H. E., Schaefer, K. P., Agris, P. F., Boak, A. M., and Kovacs, S. A. (1991) U1 snRNP association with hnRNP involves an initial non-specific splice site-independent interaction of U1 snRNP protein with hnRNA. Mol. Cell. Biochem. 106, 55–66[CrossRef][Medline]

  17. Cho, E., Takagi, T., Moore, C. R., and Buratowski, S. (1997) mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 11, 3319–3326[Abstract/Free Full Text]

  18. Dye, M. J., and Proudfoot, N. J. (1999) Terminal exon definition occurs cotranscriptionally and promotes termination of RNA polymerase II. Mol. Cell 3, 371–378[CrossRef][Medline]

  19. Hirose, Y., and Manley, J. L. (1998) RNA polymerase II is an essential mRNA polyadenylation factor. Nature 395, 93–96[CrossRef][Medline]

  20. Kim, E., Du, L., Bregman, D. B., and Warren, S. L. (1997) Splicing factors associate with hyperphosphorylated RNA polymerase II in the absence of pre-mRNA. J. Cell Biol. 136, 19–28[Abstract/Free Full Text]

  21. Knoop, L. L., and Baker, S. J. (2000) The splicing factor U1C represses EWS/FLI-mediated transactivation. J. Biol. Chem. 275, 24865–24871[Abstract/Free Full Text]

  22. Krecic, A. M., and Swanson, M. S. (1999) hnRNP complexes: composition, structure and function. Curr. Opin. Cell Biol. 11, 363–371[CrossRef][Medline]

  23. Michelotti, E. F., Michelotti, G. A., Aronsohn, A. I., and Levens, D. (1996) Heterogeneous nuclear ribonucleoprotein K is a transcription factor. Mol. Cell. Biol. 16, 2350–2360

  24. Yoshida, T., Makino, Y., and Tamura, T. (1999) Association of the rat heterogeneous nuclear RNA-ribonucleoprotein F with TATA-binding protein. FEBS Lett. 457, 251–254[CrossRef][Medline]

  25. Mayrand, S. H., and Pederson, T. (1990) Crosslinking of hnRNP proteins to pre-mRNA requires U1 and U2 snRNPs. Nucleic Acids Res. 18, 3307–3318[Abstract/Free Full Text]

  26. Mayeda, A., and Krainer, A. (1992) Regulation of alternative pre-mRNA splicing by hnRNP A1 and splicing factor SF2. Cell 68, 365–375[CrossRef][Medline]

  27. Pugh, B. F., and Tjian, R. (1991) Transcription from a TATA-less promoter requires a multisubunit TFIID complex. Genes Dev. 5, 1935–1945[Abstract/Free Full Text]

  28. Piñol-Roma, A., Swanson, M. S., Gall, J. G., and Dreyfuss, G. (1989) A novel heterogeneous nuclear RNP protein with a unique distribution on nascent transcripts. J. Cell Biol. 109, 2575–2587[Abstract/Free Full Text]

  29. Tian, H., and Kole, R. (2001) Strong RNA splicing enhancers identified by a modified method of cycled selection interact with SR protein. J. Biol. Chem. 276, 33833–33839[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Fitter and R. James
Deconvolution of a Complex Target Using DNA Aptamers
J. Biol. Chem., October 7, 2005; 280(40): 34193 - 34201.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
T100002-MCP200v1
1/2/99    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Glossary
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Journal of Lipid Research   ASBMB Today