Advertisement
MCP
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/mcp.M200006-MCP200 on February 14, 2002.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M200006-MCP200v1
1/3/213    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Glossary
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kratchmarova, I.
Right arrow Articles by Pandey, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kratchmarova, I.
Right arrow Articles by Pandey, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Molecular & Cellular Proteomics 1:213-222, 2002.
© 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

Research

A Proteomic Approach for Identification of Secreted Proteins during the Differentiation of 3T3-L1 Preadipocytes to Adipocytes*

Irina Kratchmarova{ddagger}, Dario E. Kalume{ddagger}, Blagoy Blagoev{ddagger}, Philipp E. Scherer§, Alexandre V. Podtelejnikov, Henrik Molina, Perry E. Bickel||,**, Jens S. Andersen{ddagger}, Minerva M. Fernandez{ddagger}, Jacob Bunkenborg, Peter Roepstorff{ddagger}, Karsten Kristiansen{ddagger}, Harvey F. Lodish{ddagger}{ddagger}, Matthias Mann{ddagger},¶,§§ and Akhilesh Pandey{ddagger}{ddagger},¶¶,||||

{ddagger} Center for Experimental Bioinformatics, University of Southern Denmark, Odense M, DK-5230 Denmark
§ Department of Cell Biology, Albert Einstein College of Medicine, Bronx, New York 10461
|| Departments of Medicine and Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110
MDS-Proteomics, Staermosegaardsvej 6, Odense M, DK-5230 Denmark
{ddagger}{ddagger} Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02142
¶¶ Department of Pathology, Brigham and Women’s Hospital, Boston, Massachusetts 02115


   ABSTRACT
TOP
 ABSTRACT
EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
We have undertaken a systematic proteomic approach to purify and identify secreted factors that are differentially expressed in preadipocytes versus adipocytes. Using one-dimensional gel electrophoresis combined with nanoelectrospray tandem mass spectrometry, proteins that were specifically secreted by 3T3-L1 preadipocytes or adipocytes were identified. In addition to a number of previously reported molecules that are up- or down-regulated during this differentiation process (adipsin, adipocyte complement-related protein 30 kDa, complement C3, and fibronectin), we identified four secreted molecules that have not been shown previously to be expressed differentially during the process of adipogenesis. Pigment epithelium-derived factor, a soluble molecule with potent antiangiogenic properties, was found to be highly secreted by preadipocytes but not adipocytes. Conversely, we found hippocampal cholinergic neurostimulating peptide, neutrophil gelatinase-associated lipocalin, and haptoglobin to be expressed highly by mature adipocytes. We also used liquid chromatography-based separation followed by automated tandem mass spectrometry to identify proteins secreted by mature adipocytes. Several additional secreted proteins including resistin, secreted acidic cysteine-rich glycoprotein/osteonectin, stromal cell-derived factor-1, cystatin C, gelsolin, and matrix metalloprotease-2 were identified by this method. To our knowledge, this is the first study to identify several novel secreted proteins by adipocytes by a proteomic approach using mass spectrometry.

Obesity is now increasingly recognized as a major health concern especially in the affluent world (1). Obesity predisposes a variety of other illnesses ranging from hypertension and coronary heart disease to type II diabetes mellitus. Until recently, the adipose tissue was considered to play a passive role in the body by merely acting as a storage depot for fat. However, adipocytes are involved actively in maintaining the energy balance in the body (2–4). Adipocytes have an important role in processes such as satiety, bone function, and reproduction, and most of these functions are carried out via proteins secreted by adipocytes capable of acting locally or at distant sites (5). One such example is leptin that is mainly secreted by the adipose tissue and acts on the hypothalamus to regulate food intake (6). In addition to leptin, other factors such as adipsin, tumor necrosis factor-{alpha}, insulin-like growth factor-1, vascular endothelial growth factor, and Acrp30/AdipoQ that are secreted by adipose tissue have been identified (7–11). Injection of the globular domain of Acrp30 was recently shown to cause weight loss in mice when they were maintained on a high fat and high sucrose diet again demonstrating the importance of adipocyte-specific proteins in metabolism (12).

3T3-L1 cells are an excellent model system for studying the behavior of fibroblasts as they differentiate into adipocytes when subjected to a differentiation regimen consisting of insulin, dexamethasone, and methylisobutylxanthine (mix) (13). We therefore chose preadipocytes and day 9 adipocytes to examine the profile of secreted proteins in greater detail. Several secreted proteins that were reported previously to be up- or down-regulated during the differentiation process were found in this study including several collagens, adipsin, Acrp30, complement C3, entactin/nidogen, and fibronectin. In addition, we found several molecules that were not described previously to be secreted by adipocytes or to be expressed differentially during the process of adipogenesis. For instance, PEDF,1 a serpin inhibitor with potent antiangiogenic activity (14), was detected as a protein secreted by preadipocytes but not by adipocytes. Conversely, we found an acute phase reactant, haptoglobin, and two smaller polypeptides, hippocampal cholinergic neurostimulating peptide (HCNP) and neutrophil gelatinase-associated lipocalin (NGAL), that were produced by adipocytes (15, 16). We showed that whereas haptoglobin was correspondingly up-regulated at the mRNA level, NGAL and HCNP showed no change in mRNA expression levels suggesting that the regulation of these protein levels occurs post-transcriptionally.

This study demonstrates that several secreted factors that differ between any two states can be identified in a single experiment using one-dimensional electrophoresis and tandem mass spectrometry. We also used an alternative method that avoids the gel electrophoresis step altogether. For this purpose, supernatants from mature adipocytes were digested with trypsin in solution, and the tryptic peptides were separated by liquid chromatography. The peptides were eluted and subjected to automated fragmentation and sequencing (LC-MS/MS). This procedure resulted in the identification of 12 additional molecules, five of which have not been described previously to be secreted by adipocytes. Our proteomic approach is complementary to microarray experiments using oligonucleotide or cDNA arrays, because proteins that are not differentially expressed at the mRNA levels cannot be identified using microarrays. More importantly, our proteomic analysis allowed us to enrich for and directly examine only one set of cellular proteins (secreted proteins) in detail. Identification of novel secreted molecules using this proteomic methodology will allow further detailed experiments to dissect the roles of such proteins in adipose biology and in various metabolic pathways in general.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Cell Culture, Growth Factors, and Antibodies—
3T3-L1 preadipocytes were grown in DMEM with 10% calf serum plus antibiotics in 10% CO2 at 37°C. Mouse 3T3-L1 preadipocytes were differentiated essentially as described previously (13). Briefly, cells were grown to confluence in DMEM with 10% calf serum plus antibiotics in 10% CO2. Two days after the cells reached confluence (day 0), they were induced to differentiate by changing the medium to DMEM containing 10% fetal bovine serum, 0.5 mM 3-isobutyl-1-methyxanthine (mix; Sigma), 1 µM dexamethasone (Sigma), and 167 nM insulin (Novo-Nordisk). After 48 h (day 2), the medium was replaced with DMEM supplemented with 10% fetal bovine serum and 167 nM insulin. After an additional 48 h (day 4), insulin was withdrawn, and the medium was changed every second day.

Harvesting of Supernatants from Preadipocytes and Adipocytes—
3T3-L1 cells were grown to confluency. They were then started on a differentiation protocol as described above. For metabolic labeling, the cells were washed with serum-free medium and labeled with 35S-labeled cysteine plus methionine for 6 h at every time point during the differentiation protocol. The radiolabeled supernatants were then harvested and subjected to SDS-PAGE and autoradiography.

To obtain supernatants for mass spectrometry 2 x 107 cells in a 15-cm tissue culture dish were either left undifferentiated or differentiated to day 9 according to the standard protocol. The cells were subsequently washed six times using 30 ml of serum-free medium each time and left in 12 ml of serum-free medium for an additional 18 h. Extreme care was taken not to disrupt the cells during this washing step. The supernatants were then harvested, centrifuged once, and filtered using a 0.2-µm filter. The samples were dialyzed against water (molecular mass cutoff -3500 Da; Pierce) and dried in a vacuum centrifuge. 50 µg of the protein sample (derived from ~4 x 105 cells) was loaded onto an SDS-PAGE gel that was subsequently silver-stained as described previously (17). For LC-MS/MS experiments, ~250 µg of protein sample (obtained from 2 x 106 cells) was digested by trypsin and analyzed.

RT-PCR Analysis—
Total RNA was prepared as described previously (17). Reverse transcription reactions were performed in a 25-µl volume containing 1 µg of total RNA, 3 µg of random hexamers (Amersham Biosciences), 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 40 units of RNA-guard (Amersham Biosciences), 0.9 mM dNTPs, and 200 units of Moloney murine leukemia virus reverse transcriptase (Invitrogen). Reactions were left for 10 min at room temperature, followed by incubation at 37°C for 1 h. After cDNA synthesis, the reaction mix was diluted with 50 µl of water.

Multiplex reverse transcription-polymerase chain reaction (RT-PCR) was performed essentially as described (18). Briefly, the PCR reaction was performed in a 25-µl volume containing 1.5 µl of diluted cDNA, 50 mM KCl, 10 mM Tris-HCl, pH 9.0, 1.5 mM MgCl2, 0.1% Triton X-100, 40 µM dATP, dTTP, and dGTP, 20 µM dCTP, 5 pmol of each primer, 1.25 units of Taq polymerase, and 1.25 µCi of {alpha}-32P dCTP (6000 Ci/mmol) (PerkinElmer Life Sciences). The reaction mix was denatured by heating at 94°C for 1 min. Denaturation was followed by 15, 20, or 25 cycles (depending on the set of primers used) of 94°C for 30 s, 55°C for 60 s, and 72°C for 40 s. All reactions contained the TATA-binding protein primer set as an internal standard. Reactions amplifying NGAL were performed with 25 cycles, adipsin and Acrp30 with 15 cycles, and PEDF, HCNP, and haptoglobin with 20 cycles. Ten micrometers of each reaction were dried down and resuspended in formamide dye mix (98% deionized formamide, 10 mM EDTA, pH 8.0, 0.2% bromphenol blue, 0.2% xylene cyan) and loaded onto 0.4 mm, 8 M urea, 1x TBE (Tris borate/EDTA), 6% polyacrylamide gels. Electrophoresis was performed for 3 h at 50 watts. The gels were dried and exposed overnight on a PhosphorImager storage screen and subsequently scanned on a PhosphorImager plate (Molecular Dynamics, Sunnyvale, CA).

Primers used for multiplex RT-PCR were as follows (upstream and downstream, respectively): PEDF, GCGAACTTACCAAGTCTCTGC and GGTCCAGGATTCTGCCTATGA; HCNP, TGGACGAGCTGGGCAAAGTGC and CCTGCTCGTACACCAGCCAGA; NGAL, CTCAGAACTTGATCCCTGCCC and CCAGCCCTGGAGCTTGGAACA; adipsin, TGCAGAGTGTAGTGCCTCACC and GCAGGTTGTCCGGTTCATGAT; haptoglobin, TGTTGTCACTCTCCT and CCAGCGACTGTGTTCACCCAT; Acrp30, TATCGCTCAGCGTTCAGTGTG and GGCCTGGTCCACATTCTTTTC; TATA-binding protein, ACCCTTCACCAATGACTCCTATG and ATGATGACTGCAGCAAATCGC.

Northern Blot Analysis—
20 µg of total RNA was resolved on a denaturing gel containing 1.2% agarose, 20 mM MOPS, pH 7.0, 5 mM sodium acetate, 1 mM EDTA, transferred to a Hybond membrane (Amersham Biosciences), and immobilized by UV cross-linking. Probe fragments corresponding to PEDF and haptoglobin were labeled with a Prime-It RmT Random primer labeling kit (Stratagene) using [{alpha}-32P]dCTP (6000 Ci/mmol) (PerkinElmer Life Sciences), and hybridization was performed overnight at 42°C in a buffer containing 50% deionized formamide, 2.5x Denhardt’s solution, 0.38% SDS, 50% dextran sulfate, 2.5x saline/sodium phosphate/EDTA, and 0.1 mg/ml salmon sperm DNA.

Mass Spectrometric Analysis of Secreted Proteins—
The bands indicated in Fig. 2 were excised from one-dimensional silver-stained polyacrylamide gel and processed as described (19, 20). After reduction and alkylation of bands, proteins were in-gel digested with an excess of modified, sequencing grade trypsin (Promega, Madison, WI). The digestion was carried out overnight at 37°C. After in-gel digestion, the supernatant was acidified with formic acid and loaded onto a Poros R2TM (PerSeptive Biosystems, Framingham, MA) microcolumn and desalted according to Gobom et al. (21). Subsequently the peptides were eluted with 95% methanol/5% formic acid directly into a nanoelectrospray needle (MDS-Proteomics, Odense, Denmark). Nanoelectrospray tandem mass spectrometry analysis was performed either on a Q-TOF mass spectrometer (Micromass, Manchester, United Kingdom) or on a QSTAR Pulsar (PE Sciex, Toronto, Canada) equipped with a nanoelectrospray source (MDS-Proteomics), and fragmentation spectra were obtained. The resulting "peptide sequence tags" (22) were used to search the nrdb database (EBI) using the PepSea program (MDS-Proteomics). When a peptide match was found in the database, the retrieved peptide sequence was verified against the MS/MS spectrum. LC-MS/MS analysis was performed on an Agilent Capillary LC system coupled to a quadrupole time-of-flight mass spectrometer (QSTAR Pulsar; PE Sciex, Toronto, Canada). The sample was loaded off-line onto a column packed with a 5-µm Zorbax C18 resin. Peptides were eluted using a 7–40% gradient of organic phase in 150 min. Buffer A was 0.4% acetic acid, 0.005% HFBA (heptafluorobutyric acid), and Buffer B was 90% acetonitrile, 0.4% acetic acid, 0.005% HFBA. The MS data was obtained in pulsing mode using information-dependent acquisition based on a 1-s MS survey scan followed by up to three MS/MS scans of 2 s each. The resulting data was searched against a non-redundant protein database by using MASCOT (www.matrixscience.com) and SEQUEST (ThermoFinnigan, Foster City, CA). The typical search parameters were 2-Da mass accuracy for parent ions and 50-ppm accuracy for MS/MS data. One missed cleavage was allowed. Proteins were identified based on multiple matches to peptides from the same protein, either by MASCOT score for each peptide ion or by SEQUEST Xcorr and DelCn coefficient values. For MASCOT searches, a positive score was defined to be greater than 30 for each peptide ion. Positive assignment using SEQUEST was based on Xcorr scores greater than 1.5 for singly charged peptide ions and 2.5 and 3 for doubly and triply charged ions, respectively. If only a single peptide was identified, the assignment was confirmed by manual interpretation of the MS/MS spectrum by applying a sequence tag algorithm using the PepSea database search engine.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 2. Silver-stained gels of supernatants harvested from preadipocytes and adipocytes. 3T3-L1 preadipocytes were allowed to differentiate into adipocytes, washed extensively, and grown in serum-free medium for ~18 h before harvesting the conditioned medium. For obtaining conditioned medium from preadipocytes, preconfluent 3T3-L1 preadipocytes were washed extensively and then grown in serum-free medium for ~18 h. The supernatants were resolved on 7% (panel A) or 10% (panel B) SDS-PAGE gels and then silver-stained. Protein bands that were excised and analyzed by mass spectrometry are marked with an arrow and numbered.

 

   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
CONCLUSIONS
 REFERENCES
 
A Proteomic Strategy to Identify Molecules Secreted during the Process of Adipocyte Differentiation—
Several molecules that are expressed differentially during the process of adipocyte differentiation have been identified over the course of the last decade or so. A key family of nuclear hormone receptor molecules designated as peroxisome proliferator-activated receptors and several other transcription factors including members of the CCAAT/enhancer-binding proteins and sterol regulatory element-binding protein families have been identified as critical regulators of this process (23–25). During the process of adipocyte differentiation, there is remodeling of the cells and the extracellular matrix. Several matrix molecules are now known to be up- or down-regulated as the preadipocytic fibroblasts undergo conversion into adipocytes. Although limited studies have addressed the changes in total cellular proteins of preadipocytes versus adipocytes, there are hardly any systematic studies examining the profile of proteins secreted by adipocytes compared with preadipocytes. We had shown earlier that a subtractive antibody screen was useful in identifying secreted and cell surface proteins that were specific for adipocytes (26). Using a cDNA strategy based on the presence of signal peptides, Tsuruga et al. (27) also identified several membrane-bound and secreted proteins from adipocytes.

We decided to initiate a proteomic strategy to identify all of the secreted molecules that are secreted differentially by preadipocytes and adipocytes using the 3T3-L1 model system. 3T3-L1 are preadipocytes that have the potential to differentiate into adipocytes when cultured in the presence of a mixture of dexamethasone, insulin, and mix. They have been used quite successfully by both protein-based and mRNA-based methods to isolate several molecules that are involved intimately in this differentiation process (4). Our goal was to examine the conditioned media of preadipocytes and adipocytes for proteins that are expressed differentially and to identify them by mass spectrometry. To determine the feasibility of this approach and to determine the optimal time point during the differentiation process, we first performed a pilot study with metabolic labeling of undifferentiated cells and on various days after commencing the differentiation protocol.

Fig. 1 shows a time course of the 35S-labeled proteins that are secreted into the medium. It is evident that several proteins in the high, as well as low, molecular mass range begin to be secreted around day 3 or 4 of the differentiation process and are maximally present on day 9. Some of the bands are observed maximally around day two or three and disappear by the time the cells are differentiated fully. Other bands were found to be at the same intensity during all the stages of differentiation indicating that they may be constitutively secreted proteins. Because very few proteins are not expressed either at the preadipocyte or fully differentiated adipocyte stage, we decided to concentrate only on preadipocytes and fully differentiated adipocytes. For this purpose, we took preadipocytes and adipocytes on day 9 of the standard differentiation protocol followed by washing them extensively with serum-free medium. They were then grown in serum-free medium for 18 h, and the supernatants were harvested. Fig. 2 shows one-dimensional SDS-PAGE gels after silver staining of supernatants harvested under these two conditions. One major band in Fig. 2A and two in Fig. 2B are expressed highly by preadipocytes but not by adipocytes whereas several bands are expressed more highly by adipocytes but not by preadipocytes.



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 1. Metabolic labeling of proteins secreted during the conversion of preadipocytes to adipocytes. 3T3-L1 preadipocytes were labeled metabolically with 35S before (day 0) or at the indicated days after the initiation of the differentiation protocol as described under "Experimental Procedures." The supernatants were harvested and resolved on 7% (panel A) or 15% (panel B) SDS-PAGE gels followed by autoradiography.

 
Identification of Secreted Molecules That Are Differentially Expressed by Preadipocytes and Adipocytes by Nanoelectrospray Tandem Mass Spectrometry—
The bands that were expressed differentially between preadipocytes and adipocytes compared with each other were excised, reduced and alkylated, and finally digested with trypsin. The tryptic peptides from each band were analyzed by nanoelectrospray tandem mass spectrometry. Table I shows a list of all of the proteins identified in this study, and Fig. 3shows the spectra that were obtained by tandem mass spectrometric analysis. We identified fibronectin as a down-regulated protein (band 1) that has been shown previously to be down-regulated at the mRNA level (28, 29). Down-regulation of fibronectin at the protein level was demonstrated recently and shown to be critical for adipocyte differentiation (30). We also found procollagen type I {alpha}2 (band 9) to be down-regulated during the adipocyte differentiation process. Again, it has been shown to be regulated at the mRNA level in previous studies where the mRNA transcripts were reduced by 80–90% during the adipocyte conversion process (29, 31). To our knowledge, corresponding changes in its protein levels have been presumed but not demonstrated directly to date.


View this table:
[in this window]
[in a new window]
  		TABLE I A list of secreted proteins that are up-regulated during adipogenesis

 


View larger version (36K):
[in this window]
[in a new window]
  		FIG. 3. Nanoelectrospray tandem mass spectrometric identification of four newly identified secreted molecules that are expressed differentially. Proteins separated by SDS-PAGE in Fig. 2 were subjected to in-gel digestion by trypsin and analyzed by tandem mass spectrometry. A, spectrum from MS/MS analysis of protein band 8 corresponding to PEDF. The spectrum shows the fragmentation pattern of a doubly charged parent ion. B, spectrum from MS/MS analysis of protein band 12 corresponding to haptoglobin. C, spectrum from MS/MS analysis of protein band 16 corresponding to NGAL. D, spectrum from MS/MS analysis of protein band 16 corresponding to HCNP. The y series of ions (C-terminal fragments), as well as those from the b series (N-terminal fragments), are shown. The sequence of the peptides as deduced from the spectrum and database search are given at the top of each panel.

 
Our analysis identified several up-regulated secreted proteins. Adipocyte complement-related protein 30 kDa (Acrp30), complement factor C3 precursor, and adipsin were found to be produced mainly by adipocytes. Acrp30 is a protein known to be secreted exclusively by adipocytes, and its mRNA is induced 100-fold during the process of adipocyte differentiation (10). It was also cloned in an independent study and designated as AdipoQ (11). Acrp30 has four domains; its C-terminal globular domain was shown recently to increase fatty acid oxidation in muscle and to cause weight loss in mice when they were put on a regimen of a high fat and high sucrose diet (12). Acrp30 presumably undergoes proteolytic cleavage in vivo to produce a C-terminal fragment containing the globular domain alone, which migrates at 16 kDa (12). In this study, we have identified Acrp30 from a band that migrates at 30 kDa indicating that it is the uncleaved version of Acrp30. Complement factor C3 was identified from bands 5, 7, 10, and 11. Its mRNA and protein levels have been shown previously to increase dramatically as preadipocytes differentiate into adipocytes (32, 33). Activation of C3 is a central step in the alternative complement pathway. The complement factor C3 precursor, which is ~200 kDa, is composed of {alpha} and ß chains that are linked by a disulfide bond (34). The form of C3 migrating at 110 kDa that we have identified is the {alpha} chain whereas the form migrating at 70 kDa is the ß chain. C3a and C3b are derived by proteolytic cleavage of the complement C3 precursor and correspond to its N and C terminus, respectively. Cleavage of C3a to C3adesArg makes it capable of inducing triglyceride synthesis and glucose transport indicating its intimate involvement in energy metabolism adipocytes (35–37). Adipsin was identified from bands 12 and 14 as an up-regulated protein. It was originally isolated as an mRNA species that was up-regulated over 200-fold during the adipocyte conversion process (38). It was also shown subsequently to be up-regulated at the protein level (39) and is secreted in two forms that differ in their glycosylation patterns, 37 and 44 kDa (40); both of these alternative forms of adipsin were identified in our study. Entactin/nidogen was another protein that we identified as an up-regulated protein. It was identified by Tsuruga et al. (27) as a differentially expressed mRNA using a signal sequence trap method and was shown to be up-regulated 30-fold at the protein level during adipocyte differentiation using immunoprecipitating antibodies (41). Entactin can form a ternary complex with type IV collagen and laminin thereby helping in the formation of the basement membrane (41). We found collagen type VI {alpha}3 to be secreted mainly by adipocytes confirming the results of a recent study that found this collagen expressed mainly in adipocytes using a cDNA-based subtraction strategy (42). We had also identified the {alpha}3 subunit of type VI collagen as a protein up-regulated in adipogenesis by our subtractive antibody-screening method (26).

Characterization of Four Previously Undescribed Secreted Molecules That Are Expressed Differentially—
In addition to the secreted molecules described above that have been reported previously to undergo up-regulation when preadipocytes differentiate into adipocytes, we found four secreted molecules that have not been reported previously to be expressed differentially. Fig. 2B shows a band around 50 kDa that is seen in supernatants from preadipocytes but not adipocytes. Sequencing revealed this band (band 8) to be a PEDF or stromal cell-derived factor-3 (SDF-3) (43, 44) (Fig. 3A). It belongs to the serine protease inhibitor family and induces differentiation of cultured human retinoblastoma cells into neurons (45). It has been also been shown recently to act as a potent angiogenesis inhibitor (14). Daily administration of recombinant PEDF conferred protection from ischemia-induced retinopathy in a mouse model of retinopathy (46). Multiplex RT-PCR analysis showed that PEDF mRNA transcript is expressed in preadipocytes but not in mature adipocytes (Fig. 4). To examine the time course of down-regulation of PEDF transcript, we performed a Northern blot analysis. As shown in Fig. 4B, PEDF transcript is abundant in preadipocytes but is hardly detectable by day 3. This pattern is similar to another molecule, Pref-1, that is expressed by preadipocytes but not by adipocytes (47).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4. mRNA analysis of differentially expressed secreted proteins. A, RT-PCR results of PEDF, haptoglobin, NGAL, and HCNP. Primers specific for PEDF, haptoglobin, NGAL, HCNP, adipsin, and Acrp30 were used as indicated to amplify the transcripts from total RNA isolated from preadipocytes and day 9 adipocytes. TATA-binding protein was used in every case as an internal control. B, Northern blotting to check time course of mRNA abundance of haptoglobin and PEDF. Total RNA was isolated from preadipocytes and day 9 adipocytes as in panel A, and ~20 µg was resolved by agarose gel electrophoresis and transferred to nitrocellulose. 32P-Labeled probes specific for PEDF and haptoglobin were used as described under "Experimental Procedures."

 
Several of the up-regulated bands (bands 12, 13, and 14) (Fig. 2B) were found to correspond to haptoglobin (Fig. 3B), which is a dimer of two subunits, {alpha} and ß, that are derived from processing of a single polypeptide chain. We found the partially and fully glycosylated form of prohaptoglobin migrating at 45 and 48 kDa, as well as the core glycosylated ß subunit migrating at ~38 kDa (48). Haptoglobin is an acute phase protein and is mainly synthesized by the liver and is the major hemoglobin-binding protein. Its level in plasma is sharply up-regulated during inflammation, infection, pregnancy, trauma, and malignancy. The expression of haptoglobin has been studied in some detail in hepatocytes and demonstrated to be regulated by a variety of cytokines and drugs including interleukin-1, interleukin-6, transforming growth factor-ß, dexamethasone, and forskolin (49–51). The cAMP-dependent regulation of the haptoglobin gene presumably occurs via CCAAT/enhancer-binding proteins. Up-regulation of haptoglobin production during the process of adipogenesis has not been shown previously. To test whether the up-regulation of haptoglobin was at the mRNA level, we performed a multiplex RT-PCR analysis. As shown in Fig. 4A, haptoglobin mRNA is detected in adipocytes but not in preadipocytes. A time course analysis carried out using mRNA isolated from various stages of adipocyte differentiation clearly shows the up-regulation of haptoglobin mRNA beginning at day 3 of adipogenesis (Fig. 4B).

We also found two other factors, NGAL or 24p3 and HCNP to be up-regulated in adipocytes (Fig. 3, C and D). NGAL was described originally as an oncogene whose expression increases dramatically after infection with polyoma or SV40 virus (16, 52). It belongs to a family of fatty acid-binding proteins called lipocalins (53). HCNP was isolated from hippocampal tissue and shown to cooperate with nerve growth factor in the development of medial septal nuclei (15, 54). Expression of HCNP at the protein level is induced by N-methyl-D-aspartate receptor activation and in the cerebrospinal fluids of some patients with Alzheimer’s disease (55, 56). In the case of adipocytes, multiplex RT-PCR showed that there is no alteration in the mRNA levels of these two secreted molecules suggesting that the difference in protein level may because of a post-transcriptional effect (Fig. 4A). Because of lack of commercially available good immunoprecipitating or Western blotting antibodies against these two proteins, we are unable to measure quantitatively the changes in their expression levels. Using quantitative mass spectrometry techniques that employ incorporation of a deuterium- or hydrogen-labeled affinity tag onto cysteine residues, it may be possible to quantify the expression level changes at the protein level (57).

High Throughput Automated LC-MS/MS Identification of Several Previously Undescribed Proteins Secreted by Adipocytes—
Because the analysis of bands excised from one-dimensional gels is still cumbersome, we decided to test the feasibility of avoiding gel electrophoresis altogether. To this end, we subjected the proteins isolated from supernatants of adipocytes to trypsin digestion in solution. The tryptic peptides were loaded onto a nano-LC column, eluted sequentially from the column, and the eluting peptides were fragmented on-line by the mass spectrometer (58, 59). However, because this method analyzes all of the proteins secreted by mature adipocytes and not merely the differentially expressed secreted proteins, it provides a larger catalog of proteins secreted by adipocytes. It can be quite difficult to compare two different runs in a typical LC experiment. All the molecules identified by analysis of individual bands from a one-dimension gel (with the exception of NGAL and HCNP) were again identified by LC-MS/MS. Table II lists the additional molecules that we identified by this approach. Twelve additional secreted factors were found by the LC-MS/MS approach. Three of these factors, resistin, SPARC/osteonectin, and matrix metalloprotease-2/gelatinase A, have already been implicated in the adipose tissue metabolism or obesity. Resistin was identified recently as a secreted molecule that is down-regulated (at the mRNA and protein levels) by administration of thiazolinediones, which function as insulin sensitizers (60, 61). The same molecule was obtained by homology searching by a different group and designated earlier as FIZZ3 (62). Administration of recombinant resistin induces an insulin-resistant state in mice, and resistin levels are higher in obese versus normal mice leading to the suggestion that it is involved in the pathogenesis of type II diabetes (60). SPARC/osteonectin was similarly found recently to be increased markedly in several models of obesity in mice, and its expression in adipose tissue was induced by insulin (63). Our finding of SPARC/osteonectin as a secreted adipocyte protein by LC-MS/MS confirmed our previous observations by subtractive antibody screening (26). Another molecule that we identified, matrix metalloprotease-2 or gelatinase A, was recently reported to be expressed at a higher level in gonadal fat pad of mice on a high fat diet compared with normally fed mice (64). We also identified SDF-1 or pre-B cell growth stimulating factor from adipocytes supernatants (65, 66). This CXC chemokine, which is a ligand for CXCR4/fusin (67, 68), has not been shown previously to be secreted by adipocytes. Two calcium-binding proteins, calumenin and calvasculin, previously not identified in relation to adipocytes, were also found to be secreted by adipocytes (69, 70). Also, two protease inhibitors, cystatin C and colligin-1, were found in the LC-MS/MS approach (71, 72). Of these, cystatin C was identified recently in a cDNA-based screen from adipocytes (27), and our results therefore confirm that the increased mRNA expression of cystatin C is paralleled by its protein level. Gelsolin, an actin-binding protein that is also found in plasma, was also found in our screen (73). In addition, we found that some of the proteins that we identified (e.g. vimentin and {gamma}-actin) were abundant proteins derived from the intracellular compartment presumably because of disruption of cells during washing or harvesting steps.


View this table:
[in this window]
[in a new window]
  		TABLE II A list of additional secreted proteins identified by LC-MS/MS from adipocyte supernatants

 

   CONCLUSIONS
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 CONCLUSIONS
REFERENCES
 
Proteomic methods using mass spectrometry have now been used to characterize several protein complexes such as the spliceosome (74) or for a systematic identification of proteins from organelles such as the Golgi apparatus and mitochondria, among others (75, 76). Mass spectrometry-derived data can also be used for annotation of sequence databases to identify secreted proteins and to determine their tissue expression (77). We have shown that a simple one-dimensional electrophoresis can be coupled with mass spectrometric identification of secreted proteins that are up- or down-regulated during adipogenesis. Further, LC-MS/MS can be used to identify secreted proteins in a high throughput and automatable fashion. We have identified several proteins that are involved intimately in adipose tissue biology, validating our approach. In addition, we have validated the increased expression of some proteins that were known to be up-regulated at the mRNA level. Finally, we have identified several other secreted molecules whose function in adipogenesis is not yet characterized. This strategy can be adopted easily to find novel factors whose secretion from cells is regulated by cytokines, growth factors, or drugs. Quantitation of changes in protein levels will require different strategies such as addition of isotope-coded affinity tags after harvesting of proteins (57) or labeling of growing cells in culture with stable isotope-containing amino acids.


   ACKNOWLEDGMENTS
 
We thank Keiryn Bennett for insightful discussions and Jesper Bannebjerg for expert assistance.


   FOOTNOTES
 
Received, January 11, 2002, and in revised form, February 8, 2002.

Published, MCP Papers in Press, February 14, 2002, DOI 10.1074/mcp.M200006-MCP200

1 The abbreviations used are: PEDF, pigment epithelium-derived factor; Acrp30, adipocyte complement-related protein 30; HCNP, hippocampal cholinergic neurostimulating peptide; LC, liquid chromatography; MS/MS, tandem spectrometry; NGAL, neutrophil gelatinase-associated lipocalin precursor; SPARC, secreted acidic cysteine-rich glycoprotein; DMEM, Dulbecco’s modified Eagle’s medium; MOPS, 4-morpholinepropanesulfonic acid; SDF, stromal cell-derived factor. Back

* This work was supported in part by a generous grant from the Danish National Research Foundation (to the Center for Experimental Bioinformatics). Back

** Supported by grants from the American Diabetes Association and the Clinical Nutrition Research Unit of Washington University (5P30 DK56341).Supported by grants from the American Diabetes Association and the Clinical Nutrition Research Unit of Washington University (5P30 DK56341). Back

|||| Supported by Howard Temin Award KO1 CA75447 from NCI, National Institutes of Health and by a travel award from the Plasmid Foundation, Roskilde, Denmark. To whom correspondence may be addressed: Visiting Scientist, Center for Experimental Bioinformatics, University of Southern Denmark, Odense M, DK-5230 Denmark. pandey{at}cebi.sdu.dk. Back

§§ To whom correspondence may be addressed. E-mail: mann{at}bmb.sdu.dk.


   REFERENCES
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 

  1. Kopelman, P. G. (2000) Obesity as a medical problem. Nature 404, 635 –643[Medline]

  2. Saltiel, A. R. (2001) New perspectives into the molecular pathogenesis and treatment of type 2 diabetes. Cell 104, 517 –529[CrossRef][Medline]

  3. Friedman, J. M. (2000) Obesity in the new millennium. Nature 404, 632 –634[Medline]

  4. MacDougald, O. A., and Lane, M. D. (1995) Transcriptional regulation of gene expression during adipocyte differentiation. Annu. Rev. Biochem. 64, 345 –373[CrossRef][Medline]

  5. Spiegelman, B. M., and Flier, J. S. (2001) Obesity and the regulation of energy balance. Cell 104, 531 –543[CrossRef][Medline]

  6. Auwerx, J., and Staels, B. (1998) Leptin. Lancet 351, 737 –742[CrossRef][Medline]

  7. Hotamisligil, G. S., Shargill, N. S., and Spiegelman, B. M. (1993) Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259, 87 –91[Abstract/Free Full Text]

  8. Kern, P. A., Svoboda, M. E., Eckel, R. H., and Van Wyk, J. J. (1989) Insulin-like growth factor action and production in adipocytes and endothelial cells from human adipose tissue. Diabetes 38, 710 –717[Abstract]

  9. Claffey, K. P., Wilkison, W. O., and Spiegelman, B. M. (1992) Vascular endothelial growth factor. Regulation by cell differentiation and activated second messenger pathways. J. Biol. Chem. 267, 16317 –16322[Abstract/Free Full Text]

  10. Scherer, P. E., Williams, S., Fogliano, M., Baldini, G., and Lodish, H. F. (1995) A novel serum protein similar to C1q, produced exclusively in adipocytes. J. Biol. Chem. 270, 26746 –26749[Abstract/Free Full Text]

  11. Hu, E., Liang, P., and Spiegelman, B. M. (1996) AdipoQ is a novel adipose-specific gene dysregulated in obesity. J. Biol. Chem. 271, 10697 –10703[Abstract/Free Full Text]

  12. Fruebis, J., Tsao, T. S., Javorschi, S., Ebbets-Reed, D., Erickson, M. R., Yen, F. T., Bihain, B. E., and Lodish, H. F. (2001) Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc. Natl. Acad. Sci. U. S. A. 98, 2005 –2010[Abstract/Free Full Text]

  13. MacDougald, O. A., Cornelius, P., Lin, F. T., Chen, S. S., and Lane, M. D. (1994) Glucocorticoids reciprocally regulate expression of the CCAAT/enhancer-binding protein alpha and delta genes in 3T3-L1 adipocytes and white adipose tissue. J. Biol. Chem. 269, 19041 –19047[Abstract/Free Full Text]

  14. Dawson, D. W., Volpert, O. V., Gillis, P., Crawford, S. E., Xu, H., Benedict, W., and Bouck, N. P. (1999) Pigment epithelium-derived factor: a potent inhibitor of angiogenesis. Science 285, 245 –248[Abstract/Free Full Text]

  15. Ojika, K., Kojima, S., Ueki, Y., Fukushima, N., Hayashi, K., and Yamamoto, M. (1992) Purification and structural analysis of hippocampal cholinergic neurostimulating peptide. Brain Res. 572, 164 –171[CrossRef][Medline]

  16. Hraba-Renevey, S., Turler, H., Kress, M., Salomon, C., and Weil, R. (1989) SV40-induced expression of mouse gene 24p3 involves a post-transcriptional mechanism. Oncogene 4, 601 –608[Medline]

  17. Chomczynski, P., and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 15[CrossRef]

  18. Hansen, J. B., Petersen, R. K., Larsen, B. M., Bartkova, J., Alsner, J., and Kristiansen, K. (1999) Activation of peroxisome proliferator-activated receptor gamma bypasses the function of the retinoblastoma protein in adipocyte differentiation. J. Biol. Chem. 274, 2386 –2393[Abstract/Free Full Text]

  19. Wilm, M., Shevchenko, A., Houthaeve, T., Breit, S., Schweigerer, L., Fotsis, T., and Mann, M. (1996) Femtomole sequencing of proteins from polyacrylamide gels by nano-electrospray mass spectrometry. Nature 379, 466 –469[CrossRef][Medline]

  20. Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996) Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68, 850 –858[Medline]

  21. Gobom, J., Nordhoff, E., Mirgorodskaya, E., Ekman, R., and Roepstorff, P. (1999) Sample purification and preparation technique based on nano-scale reversed-phase columns for the sensitive analysis of complex peptide mixtures by matrix-assisted laser desorption/ionization mass spectrometry. J. Mass. Spectrom. 34, 105 –116[Medline]

  22. Mann, M., and Wilm, M. (1994) Error-tolerant identification of peptides in sequence databases by peptide sequence tags. Anal. Chem. 66, 4390 –4399[Medline]

  23. Escher, P., and Wahli, W. (2000) Peroxisome proliferator-activated receptors: insight into multiple cellular functions. Mutat. Res. 448, 121 –138[Medline]

  24. Lane, M. D., Tang, Q. Q., and Jiang, M. S. (1999) Role of the CCAAT enhancer binding proteins (C/EBPs) in adipocyte differentiation. Biochem. Biophys. Res. Commun. 266, 677 –683[CrossRef][Medline]

  25. Osborne, T. F. (2000) Sterol regulatory element-binding proteins (SREBPs): key regulators of nutritional homeostasis and insulin action. J. Biol. Chem. 275, 32379 –32382[Free Full Text]

  26. Scherer, P. E., Bickel, P. E., Kotler, M., and Lodish, H. F. (1998) Cloning of cell-specific secreted and surface proteins by subtractive antibody screening. Nat. Biotechnol. 16, 581 –586[CrossRef][Medline]

  27. Tsuruga, H., Kumagai, H., Kojima, T., and Kitamura, T. (2000) Identification of novel membrane and secreted proteins up-regulated during adipocyte differentiation. Biochem. Biophys. Res. Commun. 272, 293 –197[CrossRef][Medline]

  28. Rodriguez Fernandez, J. L., and Ben-Ze’ev, A. (1989) Regulation of fibronectin, integrin and cytoskeleton expression in differentiating adipocytes: inhibition by extracellular matrix and polylysine. Differentiation 42, 65 –74[CrossRef][Medline]

  29. Zhou, L., Halvorsen, Y.-D., Cryan, E. V., Pelton, P. D., Burris, T. P., and Demarest, K. T. (1999) Analysis of the pattern of gene expression during human adipogenesis by DNA microarray. Biotechnol. Tech. 13, 513 –517[CrossRef]

  30. Selvarajan, S., Lund, L. R., Takeuchi, T., Craik, C. S., and Werb, Z. (2001) A plasma kallikrein-dependent plasminogen cascade required for adipocyte differentiation. Nat. Cell Biol. 3, 267 –275[CrossRef][Medline]

  31. Weiner, F. R., Shah, A., Smith, P. J., Rubin, C. S., and Zern, M. A. (1989) Regulation of collagen gene expression in 3T3-L1 cells. Effects of adipocyte differentiation and tumor necrosis factor alpha. Biochemistry 28, 4094 –4099[CrossRef][Medline]

  32. Choy, L. N., Rosen, B. S., and Spiegelman, B. M. (1992) Adipsin and an endogenous pathway of complement from adipose cells. J. Biol. Chem. 267, 12736 –12741[Abstract/Free Full Text]

  33. Cianflone, K., Roncari, D. A., Maslowska, M., Baldo, A., Forden, J., and Sniderman, A. D. (1994) Adipsin/acylation stimulating protein system in human adipocytes: regulation of triacylglycerol synthesis. Biochemistry 33, 9489 –9495[CrossRef][Medline]

  34. Esterbauer, H., Krempler, F., Oberkofler, H., and Patsch, W. (1999) The complement system: a pathway linking host defense and adipocyte biology. Eur. J. Clin. Invest. 29, 653 –656[CrossRef][Medline]

  35. Baldo, A., Sniderman, A. D., St.-Luce, S., Avramoglu, R. K., Maslowska, M., Hoang, B., Monge, J. C., Bell, A., Mulay, S., and Cianflone, K. (1993) The adipsin-acylation stimulating protein system and regulation of intracellular triglyceride synthesis. J. Clin. Invest. 92, 1543 –1547[Medline]

  36. Maslowska, M., Sniderman, A. D., Germinario, R., and Cianflone, K. (1997) ASP stimulates glucose transport in cultured human adipocytes. Int. J. Obes. Relat. Metab. Disord. 21, 261 –266[CrossRef][Medline]

  37. Murray, I., Parker, R. A., Kirchgessner, T. G., Tran, J., Zhang, Z. J., Westerlund, J., and Cianflone, K. (1997) Functional bioactive recombinant acylation stimulating protein is distinct from C3a anaphylatoxin. J. Lipid Res. 38, 2492 –2501[Abstract]

  38. Spiegelman, B. M., Frank, M., and Green, H. (1983) Molecular cloning of mRNA from 3T3 adipocytes. Regulation of mRNA content for glycerophosphate dehydrogenase and other differentiation-dependent proteins during adipocyte development. J. Biol. Chem. 258, 10083 –10089[Abstract/Free Full Text]

  39. Kitagawa, K., Rosen, B. S., Spiegelman, B. M., Lienhard, G. E., and Tanner, L. I. (1989) Insulin stimulates the acute release of adipsin from 3T3-L1 adipocytes. Biochim. Biophys. Acta 1014, 83 –89[Medline]

  40. Cook, K. S., Min, H. Y., Johnson, D., Chaplinsky, R. J., Flier, J. S., Hunt, C. R., and Spiegelman, B. M. (1987) Adipsin: a circulating serine protease homolog secreted by adipose tissue and sciatic nerve. Science 237, 402 –405[Abstract/Free Full Text]

  41. Aratani, Y., and Kitagawa, Y. (1988) Enhanced synthesis and secretion of type IV collagen and entactin during adipose conversion of 3T3-L1 cells and production of unorthodox laminin complex. J. Biol. Chem. 263, 16163 –16169[Abstract/Free Full Text]

  42. Imagawa, M., Tsuchiya, T., and Nishihara, T. (1999) Identification of inducible genes at the early stage of adipocyte differentiation of 3T3-L1 cells. Biochem. Biophys. Res. Commun. 254, 299 –305[CrossRef][Medline]

  43. Tombran-Tink, J., Chader, G. G., and Johnson, L. V. (1991) PEDF: a pigment epithelium-derived factor with potent neuronal differentiative activity. Exp. Eye Res. 53, 411 –414[CrossRef][Medline]

  44. Shirozu, M., Tada, H., Tashiro, K., Nakamura, T., Lopez, N. D., Nazarea, M., Hamada, T., Sato, T., Nakano, T., and Honjo, T. (1996) Characterization of novel secreted and membrane proteins isolated by the signal sequence trap method. Genomics 37, 273 –280[CrossRef][Medline]

  45. Steele, F. R., Chader, G. J., Johnson, L. V., and Tombran-Tink, J. (1993) Pigment epithelium-derived factor: neurotrophic activity and identification as a member of the serine protease inhibitor gene family. Proc. Natl. Acad. Sci. U. S. A. 90, 1526 –1530[Abstract/Free Full Text]

  46. Stellmach, V. V., Crawford, S. E., Zhou, W., and Bouck, N. (2001) Prevention of ischemia-induced retinopathy by the natural ocular antiangiogenic agent pigment epithelium-derived factor. Proc. Natl. Acad. Sci. U. S. A. 98, 2593 –2597[Abstract/Free Full Text]

  47. Smas, C. M., and Sul, H. S. (1993) Pref-1, a protein containing EGF-like repeats, inhibits adipocyte differentiation. Cell 73, 725 –734[CrossRef][Medline]

  48. Hanley, J. M., Haugen, T. H., and Heath, E. C. (1983) Biosynthesis and processing of rat haptoglobin. J. Biol. Chem. 258, 7858 –7869[Abstract/Free Full Text]

  49. Marinkovic, S., and Baumann, H. (1990) Structure, hormonal regulation, and identification of the interleukin-6- and dexamethasone-responsive element of the rat haptoglobin gene. Mol. Cell. Biol. 10, 1573 –1583[Abstract/Free Full Text]

  50. Friedrichs, W. E., Navarijo-Ashbaugh, A. L., Bowman, B. H., and Yang, F. (1995) Expression and inflammatory regulation of haptoglobin gene in adipocytes. Biochem. Biophys. Res. Commun. 209, 250 –256[CrossRef][Medline]

  51. Yu, S. J., Boudreau, F., Desilets, A., Houde, M., Rivard, N., and Asselin, C. (1999) Attenuation of haptoglobin gene expression by TGF-beta requires the MAP kinase pathway. Biochem. Biophys. Res. Commun. 259, 544 –549[CrossRef][Medline]

  52. Bundgaard, J. R., Sengelov, H., Borregaard, N., and Kjeldsen, L. (1994) Molecular cloning and expression of a cDNA encoding NGAL: a lipocalin expressed in human neutrophils. Biochem. Biophys. Res. Commun. 202, 1468 –1475[CrossRef][Medline]

  53. Flower, D. R., North, A. C., and Attwood, T. K. (1991) Mouse oncogene protein 24p3 is a member of the lipocalin protein family. Biochem. Biophys. Res. Commun. 180, 69 –74[CrossRef][Medline]

  54. Ojika, K., Mitake, S., Kamiya, T., Kosuge, N., and Taiji, M. (1994) Two different molecules, NGF and free-HCNP, stimulate cholinergic activity in septal nuclei in vitro in a different manner. Brain Res. Dev. Brain Res. 79, 1 –9[CrossRef][Medline]

  55. Tsugu, Y., Ojika, K., Matsukawa, N., Iwase, T., Otsuka, Y., Katada, E., and Mitake, S. (1998) High levels of hippocampal cholinergic neurostimulating peptide (HCNP) in the CSF of some patients with Alzheimer’s disease. Eur. J. Neurol. 5, 561 –569[CrossRef][Medline]

  56. Ojika, K., Tsugu, Y., Mitake, S., Otsuka, Y., and Katada, E. (1998) NMDA receptor activation enhances the release of a cholinergic differentiation peptide (HCNP) from hippocampal neurons in vitro. Brain Res. Dev. Brain Res. 106, 173 –180[CrossRef][Medline]

  57. Gygi, S. P., Rist, B., Gerber, S. A., Turecek, F., Gelb, M. H., and Aebersold, R. (1999) Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat. Biotechnol. 17, 994 –999[CrossRef][Medline]

  58. Washburn, M. P., Wolters, D., and Yates, J. R., III (2001) Large-scale analysis of the yeast proteome by multidimensional protein identification technology. Nat. Biotechnol. 19, 242 –247[CrossRef][Medline]

  59. Ducret, A., Van Oostveen, I., Eng, J. K., Yates, J. R., III, and Aebersold, R. (1998) High throughput protein characterization by automated reverse-phase chromatography/electrospray tandem mass spectrometry. Protein Sci. 7, 706 –719[Medline]

  60. Steppan, C. M., Bailey, S. T., Bhat, S., Brown, E. J., Banerjee, R. R., Wright, C. M., Patel, H. R., Ahima, R. S., and Lazar, M. A. (2001) The hormone resistin links obesity to diabetes. Nature 409, 307 –312[CrossRef][Medline]

  61. Olefsky, J. M., and Saltiel, A. R. (2000) PPAR gamma and the treatment of insulin resistance. Trends Endocrinol. Metab. 11, 362 –368[CrossRef][Medline]

  62. Holcomb, I. N., Kabakoff, R. C., Chan, B., Baker, T. W., Gurney, A., Henzel, W., Nelson, C., Lowman, H. B., Wright, B. D., Skelton, N. J., Frantz, G. D., Tumas, D. B., Peale, F. V., Jr., Shelton, D. L., and Hebert, C. C. (2000) FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J. 19, 4046 –4055[CrossRef][Medline]

  63. Tartare-Deckert, S., Chavey, C., Monthouel, M. N., Gautier, N., and Van Obberghen, E. (2001) The matricellular protein sparc/osteonectin as a newly identified factor up-regulated in obesity. J. Biol. Chem. 276, 22231 –22237[Abstract/Free Full Text]

  64. Lijnen, H. R., Maquoi, E., Holvoet, P., Mertens, A., Lupu, F., Morange, P., Alessi, M. C., and Juhan-Vague, I. (2001) Adipose tissue expression of gelatinases in mouse models of obesity. Thromb. Haemostasis 85, 1111 –1116[Medline]

  65. Tashiro, K., Tada, H., Heilker, R., Shirozu, M., Nakano, T., and Honjo, T. (1993) Signal sequence trap: a cloning strategy for secreted proteins and type I membrane proteins. Science 261, 600 –603[Abstract/Free Full Text]

  66. Nagasawa, T., Kikutani, H., and Kishimoto, T. (1994) Molecular cloning and structure of a pre-B-cell growth-stimulating factor. Proc. Natl. Acad. Sci. U. S. A. 91, 2305 –2309[Abstract/Free Full Text]

  67. Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana-Seisdedos, F., Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., Loetscher, M., Baggiolini, M., and Moser, B. (1996) The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell line-adapted HIV-1. Nature 382, 833 –835[CrossRef][Medline]

  68. Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodrowski, J., and Springer, T. A. (1996) The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 382, 829 –833[CrossRef][Medline]

  69. Yabe, D., Nakamura, T., Kanazawa, N., Tashiro, K., and Honjo, T. (1997) Calumenin, a Ca2+-binding protein retained in the endoplasmic reticulum with a novel carboxyl-terminal sequence, HDEF. J. Biol. Chem. 272, 18232 –18239[Abstract/Free Full Text]

  70. Jackson-Grusby, L. L., Swiergiel, J., and Linzer, D. I. (1987) A growth-related mRNA in cultured mouse cells encodes a placental calcium binding protein. Nucleic Acids Res. 15, 6677 –6690[Abstract/Free Full Text]

  71. Abrahamson, M., Grubb, A., Olafsson, I., and Lundwall, A. (1987) Molecular cloning and sequence analysis of cDNA coding for the precursor of the human cysteine proteinase inhibitor cystatin C. FEBS Lett. 216, 229 –233[CrossRef][Medline]

  72. Clarke, E. P., and Sanwal, B. D. (1992) Cloning of a human collagen-binding protein, and its homology with rat gp46, chick hsp47 and mouse J6 proteins. Biochim. Biophys. Acta 1129, 246 –248[Medline]

  73. Kwiatkowski, D. J., Stossel, T. P., Orkin, S. H., Mole, J. E., Colten, H. R., and Yin, H. L. (1986) Plasma and cytoplasmic gelsolins are encoded by a single gene and contain a duplicated actin-binding domain. Nature 323, 455 –458[CrossRef][Medline]

  74. Neubauer, G., King, A., Rappsilber, J., Calvio, C., Watson, M., Ajuh, P., Sleeman, J., Lamond, A., and Mann, M. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat. Genet. 20, 46 –50[CrossRef][Medline]

  75. Bell, A. W., Ward, M. A., Blackstock, W. P., Freeman, H. N., Choudhary, J. S., Lewis, A. P., Chotai, D., Fazel, A., Gushue, J. N., Paiement, J., Palcy, S., Chevet, E., Lafreniere-Roula, M., Solari, R., Thomas, D. Y., Rowley, A., and Bergeron, J. J. (2001) Proteomics characterization of abundant Golgi membrane proteins. J. Biol. Chem. 276, 5152 –5165[Abstract/Free Full Text]

  76. Rabilloud, T., Kieffer, S., Procaccio, V., Louwagie, M., Courchesne, P. L., Patterson, S. D., Martinez, P., Garin, J., and Lunardi, J. (1998) Two-dimensional electrophoresis of human placental mitochondria and protein identification by mass spectrometry: toward a human mitochondrial proteome. Electrophoresis 19, 1006 –1014[CrossRef][Medline]

  77. Mann, M., and Pandey, A. (2001) Use of mass spectrometry-derived data to annotate nucleotide and protein sequence databases. Trends Biochem. Sci. 26, 54 –61[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
J. Kovsan, A. Osnis, A. Maissel, L. Mazor, T. Tarnovscki, L. Hollander, S. Ovadia, B. Meier, J. Klein, N. Bashan, et al.
Depot-specific adipocyte cell lines reveal differential drug-induced responses of white adipocytes--relevance for partial lipodystrophy
Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E315 - E322.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
J. Zhang, Y. Wu, Y. Zhang, D. LeRoith, D. A. Bernlohr, and X. Chen
The Role of Lipocalin 2 in the Regulation of Inflammation in Adipocytes and Macrophages
Mol. Endocrinol., June 1, 2008; 22(6): 1416 - 1426.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
C. Natal, M. A. Fortuno, P. Restituto, A. Bazan, I. Colina, J. Diez, and N. Varo
Cardiotrophin-1 is expressed in adipose tissue and upregulated in the metabolic syndrome
Am J Physiol Endocrinol Metab, January 1, 2008; 294(1): E52 - E60.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
Q.-W. Yan, Q. Yang, N. Mody, T. E. Graham, C.-H. Hsu, Z. Xu, N. E. Houstis, B. B. Kahn, and E. D. Rosen
The Adipokine Lipocalin 2 Is Regulated by Obesity and Promotes Insulin Resistance
Diabetes, October 1, 2007; 56(10): 2533 - 2540.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
J. Adachi, C. Kumar, Y. Zhang, and M. Mann
In-depth Analysis of the Adipocyte Proteome by Mass Spectrometry and Bioinformatics
Mol. Cell. Proteomics, July 1, 2007; 6(7): 1257 - 1273.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
J. M. Gimble, A. J. Katz, and B. A. Bunnell
Adipose-Derived Stem Cells for Regenerative Medicine
Circ. Res., May 11, 2007; 100(9): 1249 - 1260.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
G. Alvarez-Llamas, E. Szalowska, M. P. de Vries, D. Weening, K. Landman, A. Hoek, B. H. R. Wolffenbuttel, H. Roelofsen, and R. J. Vonk
Characterization of the Human Visceral Adipose Tissue Secretome
Mol. Cell. Proteomics, April 1, 2007; 6(4): 589 - 600.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
N. Ogata, M. Matsuoka, K. Matsuyama, C. Shima, A. Tajika, T. Nishiyama, M. Wada, N. Jo, A. Higuchi, K. Minamino, et al.
Plasma Concentration of Pigment Epithelium-Derived Factor in Patients with Diabetic Retinopathy
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1176 - 1179.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
S. Zvonic, M. Lefevre, G. Kilroy, Z. E. Floyd, J. P. DeLany, I. Kheterpal, A. Gravois, R. Dow, A. White, X. Wu, et al.
Secretome of Primary Cultures of Human Adipose-derived Stem Cells: Modulation of Serpins by Adipogenesis
Mol. Cell. Proteomics, January 1, 2007; 6(1): 18 - 28.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Chem.Home page
Y. Wang, K. S. L. Lam, E. W. Kraegen, G. Sweeney, J. Zhang, A. W.K. Tso, W.-S. Chow, N. M.S. Wat, J. Y. Xu, R. L.C. Hoo, et al.
Lipocalin-2 Is an Inflammatory Marker Closely Associated with Obesity, Insulin Resistance, and Hyperglycemia in Humans
Clin. Chem., January 1, 2007; 53(1): 34 - 41.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
M. E. Trujillo and P. E. Scherer
Adipose Tissue-Derived Factors: Impact on Health and Disease
Endocr. Rev., December 1, 2006; 27(7): 762 - 778.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
T. Angelone, Y. Goumon, M. C. Cerra, M.-H. Metz-Boutigue, D. Aunis, and B. Tota
The Emerging Cardioinhibitory Role of the Hippocampal Cholinergic Neurostimulating Peptide
J. Pharmacol. Exp. Ther., July 1, 2006; 318(1): 336 - 344.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
S.-i. Yamagishi, H. Adachi, A. Abe, T. Yashiro, M. Enomoto, K. Furuki, A. Hino, Y. Jinnouchi, K. Takenaka, T. Matsui, et al.
Elevated Serum Levels of Pigment Epithelium-Derived Factor in the Metabolic Syndrome
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2447 - 2450.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. Vankoningsloo, A. De Pauw, A. Houbion, S. Tejerina, C. Demazy, F. de Longueville, V. Bertholet, P. Renard, J. Remacle, P. Holvoet, et al.
CREB activation induced by mitochondrial dysfunction triggers triglyceride accumulation in 3T3-L1 preadipocytes
J. Cell Sci., April 1, 2006; 119(7): 1266 - 1282.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
A. Baudry, Z.-Z. Yang, and B. A. Hemmings
PKB{alpha} is required for adipose differentiation of mouse embryonic fibroblasts
J. Cell Sci., March 1, 2006; 119(5): 889 - 897.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Larance, G. Ramm, J. Stockli, E. M. van Dam, S. Winata, V. Wasinger, F. Simpson, M. Graham, J. R. Junutula, M. Guilhaus, et al.
Characterization of the Role of the Rab GTPase-activating Protein AS160 in Insulin-regulated GLUT4 Trafficking
J. Biol. Chem., November 11, 2005; 280(45): 37803 - 37813.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
L. Xie, G. Tsaprailis, and Q. M. Chen
Proteomic Identification of Insulin-like Growth Factor-binding Protein-6 Induced by Sublethal H2O2 Stress from Human Diploid Fibroblasts
Mol. Cell. Proteomics, September 1, 2005; 4(9): 1273 - 1283.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
J. P. DeLany, Z. E. Floyd, S. Zvonic, A. Smith, A. Gravois, E. Reiners, X. Wu, G. Kilroy, M. Lefevre, and J. M. Gimble
Proteomic Analysis of Primary Cultures of Human Adipose-derived Stem Cells: Modulation by Adipogenesis
Mol. Cell. Proteomics, June 1, 2005; 4(6): 731 - 740.
[Abstract] [Full Text] [PDF]

Home page
 Diabetes and Vascular Disease ResearchHome page
E. M Scott, A. M Carter, and J. B. Findlay
The application of proteomics to diabetes
Diabetes and Vascular Disease Research, May 1, 2005; 2(2): 54 - 60.
[Abstract] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
J. E. Celis, J. M. A. Moreira, T. Cabezon, P. Gromov, E. Friis, F. Rank, and I. Gromova
Identification of Extracellular and Intracellular Signaling Components of the Mammary Adipose Tissue and Its Interstitial Fluid in High Risk Breast Cancer Patients: Toward Dissecting The Molecular Circuitry of Epithelial-Adipocyte Stromal Cell Interactions
Mol. Cell. Proteomics, April 1, 2005; 4(4): 492 - 522.
[Abstract] [Full Text] [PDF]

Home page
 Sci SignalHome page
R. Amanchy, D. E. Kalume, and A. Pandey
Stable Isotope Labeling with Amino Acids in Cell Culture (SILAC) for Studying Dynamics of Protein Abundance and Posttranslational Modifications
Sci. Signal., January 18, 2005; 2005(267): pl2 - pl2.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
J. E. Celis, P. Gromov, T. Cabezon, J. M. A. Moreira, N. Ambartsumian, K. Sandelin, F. Rank, and I. Gromova
Proteomic Characterization of the Interstitial Fluid Perfusing the Breast Tumor Microenvironment: A Novel Resource for Biomarker and Therapeutic Target Discovery
Mol. Cell. Proteomics, April 1, 2004; 3(4): 327 - 344.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Goumon, T. Angelone, F. Schoentgen, S. Chasserot-Golaz, B. Almas, M. M. Fukami, K. Langley, I. D. Welters, B. Tota, D. Aunis, et al.
The Hippocampal Cholinergic Neurostimulating Peptide, the N-terminal Fragment of the Secreted Phosphatidylethanolamine-binding Protein, Possesses a New Biological Activity on Cardiac Physiology
J. Biol. Chem., March 26, 2004; 279(13): 13054 - 13064.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
J. N. Fain, S. W. Bahouth, and A. K. Madan
Haptoglobin release by human adipose tissue in primary culture
J. Lipid Res., March 1, 2004; 45(3): 536 - 542.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. W. Rajala and P. E. Scherer
Minireview: The Adipocyte--At the Crossroads of Energy Homeostasis, Inflammation, and Atherosclerosis
Endocrinology, September 1, 2003; 144(9): 3765 - 3773.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Kalkum, G. J. Lyon, and B. T. Chait
Detection of secreted peptides by using hypothesis-driven multistage mass spectrometry
PNAS, March 4, 2003; 100(5): 2795 - 2800.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M200006-MCP200v1
1/3/213    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Glossary
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kratchmarova, I.
Right arrow Articles by Pandey, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kratchmarova, I.
Right arrow Articles by Pandey, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Journal of Lipid Research   ASBMB Today 
Advertisement
spacer
Advertisement
Advertisement