|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular & Cellular Proteomics 2:1039-1054, 2003.
© 2003 by The American Society for Biochemistry and Molecular Biology, Inc.



,¶



,||,**
,**,

From
Georg Speyer Haus, Paul-Ehrlich-Strasse 42-44, D-60596 Frankfurt am Main, Germany and
Proteome Sciences plc, Coveham House, Downside Bridge Road, Cobham, Surrey KT11 3EP, United Kingdom
| ABSTRACT |
|---|
|
|
|---|
Functional development of the mammary gland proceeds in distinct stages that are governed by the hormonal status of the animal. Before puberty, the growth of the mammary gland consists mainly of an increase of connective tissue and deposition of fat, while the mammary epithelium elongates only moderately into the mammary fat pad. This growth does not seem to depend on hormones. In females, accelerated ductal extension and branching starts at the onset of puberty under the control of systemically acting secreted ovarian steroids. Ductal arborization is initiated by intense mitotic activity and ceases only when the entire fat pad is filled with a tree-like pattern of ducts. An inner layer of luminal epithelial cells and an outer layer of contractile myoepithelial cells line the ducts, which serve as channels for milk transport during lactation. During pregnancy additional ductal branching occurs, and lobules are formed. Lobules are composed of alveoli, which in turn consist of secretory epithelial cells. These cells undergo functional differentiation and secrete milk after parturition. Upon cessation of suckling, involution of the mammary epithelium is initiated. The majority of the epithelial cells regress in size and are eliminated through apoptosis. Tissue remodeling results in a structure that resembles the gland of a nulliparous female. Proliferation and differentiation of the mammary gland is regulated by the interplay of cell-substratum and cell-cell interactions, growth factors, and peptide and steroid hormones (for review, see Ref. 1).
The HC11 cell line originated from mammary gland tissue of a mid-pregnancy BALB/c mouse (2). It is an excellent model system for studying differentiation states of mammary epithelial cells. These cells retain important characteristics of normal mammary epithelial cells, e.g. they synthesize the milk protein ß-casein in vitro upon treatment with lactogenic hormones (2, 3) and normal duct morphogenesis when injected into the cleared fat pad of syngeneic mice (3, 4).1 A crucial event in the mammary epithelial cells is the activation of the epidermal growth factor (EGF)2 receptor during the growth phase. In HC11 cells, activation of the EGF receptor promotes growth and confers competence to the cells to respond to the lactogenic hormones while inhibiting differentiation (5). After removal of EGF, differentiation of HC11 cells in vitro can be induced by the synergistic actions of insulin, glucocorticoids, and prolactin (6). Despite the enormous progress made in the past few years in the elucidation of the signal transduction pathways controlling development of the mammary gland epithelium (for review, see Ref. 7), the molecular machinery governing the switch from proliferation to differentiation has only been described in a rudimentary fashion. Several groups have investigated protein expression patterns of normal or cancer mammary epithelial cells (812), but no data is available about the changes in protein expression that accompany mammary epithelial cell differentiation.
Therefore, we have used a systematic approach to study the patterns of proteins whose expression varies upon the differentiation of HC11 cells. This approach provided new insights into the proteins involved in mammary epithelial cell differentiation.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
High Resolution Two-dimensional Gel Electrophoresis
HC11 cells were suspended in ice-cold lysis buffer (4 M urea, 50 mM HEPES, 5 mM EDTA, 10 mM Mg2SO4, pH 8.5) supplemented with protease inhibitors and were disrupted by sonication. Lysates were cleared of nucleic acids by treatment with Benzonase® (Merck, 5,000 units/g of cells) for 90 min at 4 °C. Cell debris and remaining intact cells were removed by centrifugation for 15 min at 20,000 x g and 4 °C. Total proteins were precipitated with trichloroacetic acid and solubilized in a sample solution containing 6 M urea, 2 M thiourea, 4% (w/v) CHAPS, 75 mM dithiothreitol, 0.5 mM EDTA, 5 mM Pefabloc, 0.01% (v/v) Orange G, 1% (v/v) Ampholines, pH 3.59.5 (Amersham Biosciences), and 1% (v/v) Pharmalytes, pH 310 (Amersham Biosciences). Immobilized pH gradient strips (18 cm, pH 47 linear (Xzillion) or 611 linear (Amersham Biosciences)) were rehydrated overnight with sample solution omitting the protein sample. Subsequently, samples were applied to the immobilized pH gradient strips by cup loading. Isoelectric focusing of the first dimension was then performed for
78,000 Volt hours at 17 °C. The equipment for running of the immobilized pH gradient strips (IPGPhor) was purchased from Amersham Biosciences. In the second dimension, proteins were separated according to their molecular mass using 12% SDS-PAGE gels (19 x 23 cm) run at 10 °C with a DALT-1 electrophoresis apparatus (Amersham Biosciences) set at 1000 milliampere hours per gel.
Four analytical gels (150 µg of proteins) were run for each sample. They were silver-stained for protein pattern analysis as described previously (13), except that glutardialdehyde was omitted from the sensitizing solution. Preparative gels (600 µg of proteins), loaded with extracts from undifferentiated (pI 47) or differentiated (pI 6.511) HC11 cells, were stained with Coomassie Blue (14) for mass spectrometry analysis.
Analysis of 2-D Gel Spot Patterns
To obtain significant measurements of protein expression, we ran four replicate analytical gels for each experimental condition. The replicates were scanned with standardized parameters using a high sensitivity flatbed scanner (ImageScanner, Amersham Biosciences), and scanned gel images were processed by the Proteomics Software SystemTM (PSS) developed by Xzillion (Frankfurt am Main, Germany). A master gel was computed by registering and jointly segmenting the multiple registered replicates; for algorithmic details refer to Baker et al. (15). Spot volumes were determined by modeling the optical density in individual spot segments by a two-dimensional Gaussian analysis. A spot was considered only if detected in at least 50% of the replicates (i.e. each spot was present in two or more of the four replicates). Comparative analysis was undertaken by matching master gels of reference and test samples in a semiautomatic manner. First, an automatic algorithm that solves the point-matching problem for two sets of spot coordinates was applied; for algorithmic details see Gold et al. (16). Subsequent manual editing of the automatic matching refined the results. Differential expression was assessed by calculation of the spot
volumes, representing the ratio between the volume of a spot in the test gel (differentiated cells) and the volume of this spot in the reference gel (undifferentiated cells). Spots were considered significantly up- (or down-) regulated if the corresponding volumes showed an increase (or decrease) by a factor of
2 when comparing reference to test gels. Thereafter, analytical and preparative gels were matched as described above, and a list of spot coordinates was generated for subsequent analysis.
Protein Isolation and Digestion
The protein spots of interest were excised from the preparative 2-D gels, washed, and digested with trypsin. They were analyzed in a fully automatic manner on a spot-handling platform (Ettan spot-handling platform, Amersham Biosciences) according to the manufacturers instructions.
Protein Identification by Matrix-assisted Laser Desorption/Ionization Mass Spectrometry Analysis
Mass spectra of the tryptic digests were derived on a Voyager STR (Applied Biosystems) matrix-assisted laser desorption/ionization time-of-flight mass spectrometer equipped with delayed extraction (17). 0.5 µl of each analyte solution was allowed to dry, and 0.5 µl of matrix solution (10 g/liter
-cyano-4-hydroxycinnamic acid in 49.9% water/49.9% acetonitrile/0.2% trifluoroacetic acid) was added. After a two-point calibration, the mass accuracy was in most cases better than 10 ppm (
m/m); therefore, the mass tolerance was set to 15 ppm. A mass list of peptides was obtained for each protein digest. This peptide mass fingerprint was then submitted to an appropriate software to perform database searches and identify the proteins (MS Fit, Applied Biosystems).
Western Blot Analysis
Cells were harvested in ice-cold lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40, and protease and phosphatase inhibitors). Extracts were incubated for 15 min on ice, and cellular debris was removed by centrifugation for 15 min at 12,000 x g. Protein concentrations were determined by Bradford. Equal amounts of proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes. Blots were stained with Ponceau S to visualize loaded proteins, and immunodetection was performed using specific antibodies. ß-Casein-specific antiserum was a kind gift from Itamar Barash (Bet Dagan, Israel). Antiannexin I was from Zymed Laboratories Inc.. Antibodies against Hsp27, the receptor for activated C kinases (RACK1), proliferating cell nuclear antigen (PCNA), and T-complex protein 1
(TCP-1-
) were from Santa Cruz Biotechnology, Inc.
Real Time Quantitative Reverse Transcription-PCRs
Total RNA from undifferentiated HC11 cells and HC11 cells that had been induced to differentiate for 1 day was prepared using peqGOLD TriFastTM (peqLab Biotechnology, Erlangen, Germany) following the manufacturers instructions. RNA was reverse transcribed at 42 °C for 1 h using avian myeloblastosis virus reverse transcriptase (Invitrogen). The PCR reactions were performed in an iCycler (Bio-Rad) with 5 µl of the cDNA diluted 1:5 or 1:50, 100 pmol of primers, 12.5 nmol of dNTPs, SYBR Green (Bio-Rad), and 2.5 units of AmpliTaq® DNA polymerase (PerkinElmer Life Sciences) in a 50-µl reaction. The PCR primers used were as follows: annexin I sense, GCAAAGGCAGACGAGCAG; annexin I antisense, CTTCACCCCGGCATCATAGAG; TCP-1-
sense, CTGGTGCCATGGCTGTTAGGAGA; TCP-1-
antisense, CAAATTGGCCAGCGTAGACAGGA; HSP27 sense, CAAGGAAGGCGTGGTGGAGAT; HSP27 antisense, ACCTGGAGGGAGCGTGTATTT; PCNA sense, AGAGGAGGCGGTAACCATAGAGAT; PCNA antisense, TAGGAGACAGTGGAGTGGCTTTTG; RACK1 sense, GAATGGGTGTCTTGTGTCC; RACK1 antisense, CTTGCAGTTAGCCAGATTC; ß-casein sense, TCACTCCAGCATCCAGTCACA; ß-casein antisense, GGCCCAAGAGATGGCACCA; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sense, GATGACATCAAGAAGGTGGTG; and GAPDH antisense, GCTGTAGCCAAATTCGTTGTC.
Relative quantification of the PCR products was performed by comparing the threshold cycle (Ct) of different samples. Ct was defined as the fractional cycle number at which the amount of amplified target reached a fixed threshold. The Ct value correlated with input target mRNA levels, and a lower Ct value indicated a higher starting copy number. It is assumed that a difference of one cycle in the linear phase of the reaction corresponds to a 2-fold difference in transcript levels between samples.
Rhodamine-Phalloidin Staining of Cellular Actin
Cells were left undifferentiated or induced to differentiate for 4 days, fixed with formaldehyde, and stained with phalloidin-tetramethylrhodamine ß-isothiocyanate (TRITC) conjugate (Sigma) to visualize actin as described previously (18).
| RESULTS |
|---|
|
|
|---|
|
|
|
11.0. Among them, around 60 proteins increased or decreased during differentiation (Tables I and II). It should be noted that the gel system used in these experiments did not allow simultaneous separation of acidic and basic proteins. Two preparative 2-D gels were used for spot isolation and mass spectrometric identification of proteins. They displayed spots of pI 47 or pI 6.511 and were loaded with extracts from undifferentiated and differentiated cells, respectively. Therefore, we could not identify basic proteins (pI >7) exclusive for the undifferentiated state and acidic proteins (pI <6.5) exclusive for the differentiated state. This is the case, for example, for ß-casein, an acidic protein (pI
5) expressed specifically in differentiated mammary epithelial cells (Fig. 1).
|
|
|
(Table I, spot 240) was down-regulated, TCP-1-
(spot 263) was up-regulated during differentiation of HC11 cells. Members of the HSP70 (GRP78, spots 163 and 166; Hsc71, spots 177, 179, and 181; and HSP70, spot 183), HSP60 (HSP60, spots 262, 269, and 270), and the small HSP (HSP27, spot 781) families of heat shock proteins were expressed preferentially in undifferentiated cells. They function as molecular chaperones by binding to a substrate protein and facilitating its correct folding in vivo (for review, see Ref. 20). Increasing evidence suggests that besides the TCP-1 complex, the HSP family of chaperones may play a role in the formation and function of the cytoskeleton (19). These data suggest that significant reorganization of the cytoskeleton accompanies mammary epithelial cell differentiation.
Proteasomal Proteins
Expression of two subunits of the proteasome was inversely regulated during HC11 differentiation. The proteasome is the major proteolytic complex of eukaryotic cells, primarily essential for degradation of polyubiquitinated proteins. It consists of a 20 S proteolytic core particle and a 19 S regulatory particle responsible for recognition of ubiquitinated substrates (21). The 20 S proteolytic core can also associate with complexes other than the 19 S particle (2124); however, the physiological significance of these interactions is not clear. Our data show that S5a, a component of the 19 S complex, is down-regulated (spot 374), whereas another subunit of the proteasome, subunit ß type 2 (spot 448), is up-regulated after HC11 differentiation. The proteasome has been implicated in the proteolysis of transcription factors, cell cycle regulatory proteins, oncogenes, tumor suppressors, and proteins involved in cellular differentiation (2528). The rapid degradation of certain regulatory proteins is important in the stringent control of their signaling activity (25, 26). Our results suggest that activity of the proteasome may be modulated by differential expression of specific subunit components during mammary epithelial cell differentiation.
Calcium-binding Proteins
Two families of calcium-binding proteins were highly regulated during differentiation of HC11 cells: calmodulin and annexins. These proteins are involved in many cellular processes, and binding to calcium regulates their activity. Annexins are phospholipid-binding proteins that may cross-link plasma membrane phospholipids, actin, and the cytoskeleton (29) to regulate proliferation (30), exocytosis (31), and membrane fusion (32). Annexin I expression correlates with cell proliferation (30, 33), and its overexpression blocks intracellular calcium release and inhibits cell adhesion and differentiation (34). Conversely, annexin II levels are 32-fold higher in PC-12 cells that cease proliferation and undergo reversible differentiation into non-dividing neuron-like cells in response to nerve growth factor (30). We also found a strong up-regulation of annexin II levels in differentiated HC11 cells (spots 280 and 294). It is believed that annexin II plays a role in exocytosis (31). The up-regulation of annexin II in differentiated HC11 cells suggests that this protein might play a role in the secretion of milk constituents. This is in agreement with the studies of Handel et al. (35), who detected annexin II associated with secretory vesicles at the apical membrane of actively secreting mammary epithelial cells. We found an up-regulation of annexin I in differentiated HC11 cells. This is not in agreement with a previously assigned role of annexin I in proliferation. However, we identified two spots containing annexin I, only one of which was up-regulated in differentiated cells (Table I, spot 264, and data not shown). It is therefore possible that a post-translational modification of annexin I might accompany a functional modification. Together, these results suggest a role for calcium in differentiation of mammary epithelial cells, probably through regulation of the actin cytoskeleton and exocytosis.
Regulators of Intracellular Signaling
Our data present the first indication for a role of 14-3-3
and RACK1 in mammary gland differentiation. Expression of these two extracellular signaling proteins is inversely regulated during HC11 cell differentiation. We found higher expression of 14-3-3
(spot 749) in undifferentiated cells. 14-3-3
belongs to a family of highly conserved and abundant proteins found throughout the eukaryotic kingdom. They exist in multiple isoforms and have been implicated as key regulators of diverse cellular processes such as signal transduction, cell cycle control, apoptosis, stress response, and malignant transformation. They mediate their effects through binding to phosphoserine-containing sequence motifs in diverse partners, thereby acting as (1) adaptor molecules stimulating protein-protein interactions, (2) regulators of subcellular localization of proteins, and (3) activators or inhibitors of enzymes (for review, see Ref. 36). 14-3-3
, and not 14-3-3
/ß or
/
, is strongly down-regulated in breast cancer cells (11, 12), suggesting that each isoform might have a distinct function. In contrast to 14-3-3
, we measured a 5-fold increase in expression of RACK1 (spot 345) after differentiation of HC11 cells. RACK1 is an adaptor molecule that binds only the activated form of protein kinase C, directing the localization of the activated enzymes to distinct cellular compartments (37). In addition to anchoring activated protein kinase C isozymes, RACK1 anchors other signaling enzymes, including Src tyrosine kinase (38), Fyn (39), and phosphodiesterase (40), and associates with integrins (41), type I interferon (42), and insulin-like growth factor I receptors (43). Interestingly, it was recently demonstrated that RACK1, by recruiting Stat1 to the type I interferon receptor, plays an essential role in signaling through the Jak-Stat pathway (42). Signaling through the Jak-Stat pathway controls epithelial differentiation throughout development of the mammary gland (44), and it is likely that RACK1 is also essential for differentiation of the mammary epithelium. Furthermore, RACK1 seems to favor cellular differentiation by inhibiting progression of the cell cycle (38) and mediating cell spreading and contact with extracellular matrix via integrin and focal adhesion molecules (43). This, together with the strong induction of RACK1 that we detected in extracts from the differentiated HC11 cells, suggests that RACK1 might be a major player in the differentiation of mammary epithelial cells, probably by regulating multiple signaling pathways.
Regulators of Transcription and RNA Processing
Two transcription factors were identified that exhibit an opposed expression pattern during differentiation. PCNA is a component of the replication and DNA repair machinery and a known marker of cellular proliferation (45). We found that PCNA (spot 655) levels are greatly elevated in undifferentiated cells, which correlates well with the proliferating state of these cells. Conversely, the CArG box-binding factor-A (CBF-A, spot 248) was found to be expressed exclusively in differentiated cells. This protein was originally identified as a transcriptional repressor (46, 47) and has also been shown to activate transcription of the Ha-ras gene (48). In addition, CBF-A belongs to the family of heterogeneous nuclear ribonucleoproteins (hnRNPs) that bind pre-mRNAs (46). Indeed, increased expression of CBF-A results in enhanced stability of target mRNAs (49). Thus, CBF-A acts both on transcriptional and post-transcriptional processes in gene expression.
In addition to the effects on CBF-A, differentiation had an effect on the expression of a wide range of proteins controlling RNA processing. Proteins functioning in nearly every step of RNA processing were found to be regulated: transcription (CBF-A), pre-mRNA splicing (hnRNP F, spot 149; K, spot 259; A1, spot 421; and A2/B1, spots 275, 306, and 348), nuclear export (Ran/TC4, spots 405 and 408, and hnRNP arginine N-methyltransferase (50), spot 267), stability (CBF-A), translation (eIF-4A, spot 443, and tRNA methyltransferase, spot 374), and localization (MARTA1 (51), spot 53). These data suggest interesting possibilities for a role of mRNA maturation, export, and localization in mammary epithelial cell differentiation.
Glycolytic Proteins
A very striking feature of the differentiated cells was the high induction of proteins involved in the glycolytic pathway, e.g. in the conversion of glucose to pyruvate (aldolase A, spot 248; phosphoglycerate kinase 1, spot 207; phosphoglycerate mutase, spot 381; GAPDH, spots 260 and 270; and pyruvate kinase, spot 101). A similar observation was made in mammary tumor models (52), where it probably reflects accelerated rates of metabolism. Activation of the glycolytic pathway ultimately serves the synthesis of ATP. Differentiated mammary epithelial cells, whose function is to constantly secrete milk proteins and lipids into the ducts of the gland, require energy for this polarized secretion. Therefore, it seems reasonable that these cells activate the glycolytic pathway to support their need for energy. Alternatively, enzymes of this pathway might play a role in differentiation. For example, decrease in pyruvate kinase activity has been shown to correlate with differentiation of trypanosomes (53) and mouse embryonal carcinoma cells (54, 55). On the other hand, expression of this enzyme increases during differentiation of neuronal cells (56).
Extracellular Matrix
We also found regulated expression of an enzyme controlling extracellular matrix composition; undifferentiated cells displayed a 2-fold increased expression of hyaluronan synthase 3 (spot 84). Hyaluronan synthases 1, 2, and 3 are responsible for the production of hyaluronan, a component of extracellular and cell-associated matrices essential for growth and motility (57, 58). Interestingly, hyaluronan is essential for ductal branching of the prostate gland epithelium (59). This and the regulation of hyaluronan synthase expression during differentiation of HC11 cells suggest that hyaluronan might be important for differentiation of mammary epithelial cells. However, overproduction of hyaluronan is thought to be directly involved in tumorigenesis and metastasis. Increased levels of hyaluronan in urine and serum are often associated with advanced cancers (60, 61). Presumably, hyaluronan promotes tumor growth by stimulating intrinsic cell growth rates and angiogenesis (62, 63) and promoting metastasis (64). Together, our data suggest that hyaluronan synthases play a role in the normal development of the mammary gland and that their deregulated expression might contribute to the development of breast cancer.
Validation of the Observed Protein Expression Profiles and Fluorescence Microscopy
To confirm some of the changes in protein expression during differentiation, we performed Western blot and quantitative PCR analyses for some differentially expressed proteins. As expected, while the protein levels of annexin I and RACK1 increased with differentiation, TCP-1-
, heat shock protein 27, and PCNA were expressed preferentially in proliferating cells (Fig. 5A). Interestingly, two isoforms of annexin I were visualized on Western blots (Fig. 5A) and on the 2-D gels (data not shown). Presence of two isoforms might indicate that this protein is subject to post-translational modification during differentiation. The changes in protein expression did not always correlate with mRNA levels (Fig. 5B). In some cases, including annexin I, RACK1, and GAPDH, we observed no variation in mRNA amounts, or even opposite regulation of the mRNA. These results indicate that many of the changes that accompany differentiation of mammary epithelial cells occur at the translational or post-translational level.
|
|
| DISCUSSION |
|---|
|
|
|---|
Several of these proteins are expected to be regulated in polarized mammary epithelial cells that depend upon vesicle movement along cytoskeletal elements to achieve secretion of milk components. Among these are actin-binding proteins, chaperones, a subunit of a microtubule motor complex, and proteins regulating aggregation and fusion of vesicles. Remarkably, differentiation of HC11 cells also resulted in the induction of a series of proteins involved in mRNA processing, localization, and translation. Regulation of several of these proteins was corroborated by different experimental approaches, including 2-D gel electrophoresis, Western blotting, and fluorescence microscopy, and allowed us to propose new concepts regarding mammary epithelial cell differentiation.
Cellular differentiation, generally associated with phenotypic modifications of the cell, often involves reorganization of the actin cytoskeleton (66). Microscopic observation of mouse mammary glands indicated that differentiated cells have an increased cell size and undergo changes in cell shape and polarization (67). The acquisition of apical basal polarity is apparent, for example, at the final step of differentiation, during lactation when milk proteins are secreted through the luminal side of mammary alveolar cells. Cell polarization is a complex phenomenon dependent on rearrangement of the actin cytoskeleton (68, 69).
Vectorial secretion of vesicles also depends on actin-based motility (70). Secretory vesicles containing milk proteins require transport on microtubules. Once they reach the apical plasma membrane, local reorganization of actin and activity of specialized proteins might allow fusion and exocytosis. In undifferentiated HC11 cells, we found the presence of actin stress fibers throughout the cells. In differentiated cells, however, actin was concentrated at the plasma membrane, where exocytosis occurs. In addition, these cells exhibit increased expression of proteins involved in exocytosis, for example, a protein showing similarity to dynactin 2, a subunit of the dynactin macromolecular complex and annexin II. Dynactin binds to dynein, a biological motor protein that provides a force for intracellular motility of organelles and vesicles along microtubules (71). Annexin II is a protein that links the plasma membrane to the cytoskeleton in a calcium-dependent manner and whose importance for exocytosis has been documented (7274). The remodeling of the actin cytoskeleton in parallel with the up-regulation of the microtubule motor protein dynactin 2 and annexin II is consistent with the acquisition of secretory functions in differentiated HC11 cells.
The importance of actin rearrangements during mammary gland development was demonstrated by analysis of gelsolin-deficient mice. Gelsolin is the founding member of a family of actin-binding proteins involved in controlling the organization of the actin cytoskeleton in cells (for review, see Ref. 75). Gelsolin severs actin filaments in the presence of submicromolar amounts of calcium, thereby disassembling the actin network. Although embryonic development and longevity were normal in mice lacking gelsolin, migration of neutrophils and dermal fibroblasts was decreased (76), indicating that gelsolin is required for rapid motile responses in some cell types, such as those involved in hemostasis, inflammation, and wound healing. In addition, lack of gelsolin resulted in defects in mammary gland development. Some mice exhibited only rudimentary structures until 9 weeks of age, whereas all female adults had no terminal branching and displayed delayed alveolar development during pregnancy. These defects were only transient as lactation and involution were normal (77). The requirement of gelsolin for ductal development of the mammary epithelium is not surprising. Gelsolin mediates EGF effects on cell motility (78), and EGF controls ductal outgrowth, elongation, and branching (for review, see Ref. 1). We detected enhanced expression of gelsolin in undifferentiated HC11 cells. This supports the notion that gelsolin is required during early development of the mammary gland.
HSP27 is also part of a signaling pathway regulating the dynamics of actin filaments (79). This protein was found to be more abundant in undifferentiated cells. Interestingly, HSP27 has been shown to be essential for the differentiation of mouse embryonic stem cells (80). The existence of stem cells has also been demonstrated in the mammary epithelium (81, 82), and the HC11 cell line maintains stem cell properties as it can recapitulate normal duct morphogenesis upon transplantation into the cleared fat pad of mice (4). The fact that expression of HSP27 varies upon differentiation of HC11 cells suggests that it is also involved in differentiation of mammary epithelial cells and that signaling pathways governing differentiation might be conserved between embryonic and adult stem cells. Proteomics analysis found that proteins preferentially expressed in undifferentiated HC11 cells are also increased in expression in mammary tumor samples. These include HSP27, GRP78, protein disulfide isomerase, HSP60, and PCNA (10, 11, 83, 84). High expression of these proteins in the undifferentiated cells is not surprising and might be associated with proliferation.
RNA-interacting proteins were found to be a major class of proteins regulated during differentiation of HC11 cells. This suggests that post-transcriptional control of gene expression might play a central role in mammary epithelial cell differentiation. This is consistent with observations in which the induction of lactogenic hormones has been described to induce a factor responsible for post-transcriptional stabilization of ß-casein mRNA (85, 86). Moreover, we have identified previously a cellular factor that represses the transcription of the ß-casein gene and that, during lactation of animals and after lactogenic hormone induction of HC11 cells in culture, bound to the ß-casein RNA and remained sequestered in the cytoplasm (87). CBF-A, a factor identified to be differentially regulated in our screen, also seems to possess this dual ability to control transcription (4648) and to be able to bind to RNA (46, 49). The regulated expression of CBF-A during mammary epithelial cell differentiation might result in controlled stability of target mRNAs.
Another means of post-transcriptional control of gene expression consists of the regulation of mRNA subcellular localization. Asymmetric intracellular distribution of specific mRNAs can generate cell polarity by controlling translation sites and by restricting particular proteins to specific subcellular compartments (88, 89). For example, the localization of ß-actin mRNA has been shown to be asymmetric (9092) depending on the activity of a splicing regulatory protein (93). Interestingly, this splicing factor is homologous to MARTA1, isolated as a protein interacting with microtubule-associated protein 2 (MAP2) mRNAs (51), which is targeted to dendrites in neuronal cells (94). We observed up-regulation of a protein homologous to rat MARTA1 in differentiated HC11 cells, suggesting that regulation of mRNA localization might occur during mammary epithelial cell differentiation and contribute to the establishment of cellular polarity.
About 80% of the protein species identified in the mouse mammary gland differ in their theoretical Mr and pI values as a result of post-translational modifications (8). Accordingly, many of the proteins that we have identified migrated on the 2-D gels as several spots that were differently regulated (see Tables I and II). For example, 9 spots were identified for hnRNPA2/B1, and among them 3 were up-regulated during differentiation. This suggests that the different protein isoforms might have distinct roles during differentiation.
The comparative analysis of protein expression patterns from the two stages of mammary epithelial cell differentiation yielded interesting and interpretable results. This analysis, however, cannot be considered comprehensive. There are experimental limitations that have to be kept in mind. Even the sophisticated protein separation and identification methods used only allow the analysis of a subset of proteins. Proteins outside the pH range of the isoelectric focusing procedure or proteins expressed at low levels might escape detection. In addition, the HC11 cell line is certainly a valuable and suitable experimental model but does not necessarily reflect the entire complexity of the in vivo situation. The lactogenic hormone-induced pattern of protein expression we observed in our experiments represents the state of fully differentiated mammary epithelial cells. It does not account for proteins that are involved in the early steps of mammary epithelial cell differentiation. Although it is known that the Jak-Stat signaling pathway plays major roles in the development of the mammary gland epithelium (for review, see Ref. 44), the molecular machinery governing the switch from proliferation to differentiation in these cells is poorly understood. Experiments in which we try to account for these limitations, e.g. the use of HC11 cells hormonally induced for different time periods or the analysis of subcellular fractions, might provide further insights into the signaling pathways and functional differentiation processes underlying mammary gland development.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Published, MCP Papers in Press, July 28, 2003, DOI 10.1074/mcp.M300032-MCP200
1 S. Desrivières and B. Groner, unpublished observations. ![]()
2 The abbreviations used are: EGF, epidermal growth factor; CBF-A, CArG box-binding factor-A; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 2-D, two-dimensional; hnRNP, heterogeneous nuclear ribonucleoprotein; Hsp, heat shock protein; Ct, threshold cycle; PCNA, proliferating cell nuclear antigen; RACK-1, receptor for activated C kinases; TCP-1, T-complex protein 1; TRITC, tetramethylrhodamine ß-isothiocyanate; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid. ![]()
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ![]()
¶ Present address: Ciphergen Biosystems GmbH, Hannah-Vogt Strasse 1, D-37085 Göttingen, Germany. ![]()
|| Present address: Dept. of Biological Sciences, 2500 University Dr. N.W., Calgary, Alberta, Canada. ![]()
** Both authors contributed equally to this work. ![]()

To whom correspondence should be addressed. Tel.: 49-069-633-95183; Fax: 49-069-633-95185; E-mail: Groner{at}em.uni-frankfurt.de
| REFERENCES |
|---|
|
|
|---|