Advertisement
MCP
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/mcp.M300032-MCP200 on July 28, 2003.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M300032-MCP200v1
2/10/1039    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Glossary
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Desrivières, S.
Right arrow Articles by Groner, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Desrivières, S.
Right arrow Articles by Groner, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Molecular & Cellular Proteomics 2:1039-1054, 2003.
© 2003 by The American Society for Biochemistry and Molecular Biology, Inc.


Research

Comparative Proteomic Analysis of Proliferating and Functionally Differentiated Mammary Epithelial Cells*

Sylvane Desrivières{ddagger}, Thorsten Prinz§, Nahomi Castro-Palomino Laria{ddagger}, Markus Meyer§,, Gitte Boehm§, Ute Bauer§, Jürgen Schäfer§, Thomas Neumann§, Carrie Shemanko{ddagger},||,** and Bernd Groner{ddagger},**,{ddagger}{ddagger}

From {ddagger} Georg Speyer Haus, Paul-Ehrlich-Strasse 42-44, D-60596 Frankfurt am Main, Germany and § Proteome Sciences plc, Coveham House, Downside Bridge Road, Cobham, Surrey KT11 3EP, United Kingdom


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Proliferation and differentiation of mammary epithelial cells are governed by hormonal stimuli, cell-cell, and cell-matrix interactions. Terminal differentiation of mammary epithelial cells depends upon the action of the lactogenic hormones, insulin, glucocorticoids, and prolactin that enable them to synthesize and secrete milk proteins. These differentiated cells are polarized and carry out vectorial transport of milk constituents across the apical plasma membrane. To gain additional insights into the mechanisms governing differentiation of mammary epithelial cells, we identified proteins whose expression distinguishes proliferating from differentiated mammary epithelial cells. For this purpose we made use of the HC11 mammary epithelial line, which is capable of differentiation in response to lactogenic hormones. Using two-dimensional gel electrophoresis and mass spectrometry, we found about 60 proteins whose expression levels changed in between these two differentiation states. Bioinformatic analysis revealed differential expression of cytoskeletal components, molecular chaperones and regulators of protein folding and stability, calcium-binding proteins, and components of RNA-processing pathways. The actin cytoskeleton is asymmetrically distributed in differentiated epithelial cells, and the identification of proteins involved in mRNA binding and localization suggests that asymmetry might in part be achieved by controlling cellular localization of mRNAs. The proteins identified provide insights into the differentiation of mammary epithelial cells and the regulation of this process.


The mammary gland is an organ that emerged relatively late in evolution and defines the class of Mammalia. It is specialized in the synthesis and secretion of large quantities of milk essential for the survival and growth of the newborn. This gland represents a most suitable system for the study of organogenesis. Its development is gradual and occurs mainly after birth, i.e. during puberty and pregnancy. In addition, it is easily accessible for manipulation, it is non-vital, and it has the unique ability to involute and to regenerate during successive cycles of pregnancy and lactation.

Functional development of the mammary gland proceeds in distinct stages that are governed by the hormonal status of the animal. Before puberty, the growth of the mammary gland consists mainly of an increase of connective tissue and deposition of fat, while the mammary epithelium elongates only moderately into the mammary fat pad. This growth does not seem to depend on hormones. In females, accelerated ductal extension and branching starts at the onset of puberty under the control of systemically acting secreted ovarian steroids. Ductal arborization is initiated by intense mitotic activity and ceases only when the entire fat pad is filled with a tree-like pattern of ducts. An inner layer of luminal epithelial cells and an outer layer of contractile myoepithelial cells line the ducts, which serve as channels for milk transport during lactation. During pregnancy additional ductal branching occurs, and lobules are formed. Lobules are composed of alveoli, which in turn consist of secretory epithelial cells. These cells undergo functional differentiation and secrete milk after parturition. Upon cessation of suckling, involution of the mammary epithelium is initiated. The majority of the epithelial cells regress in size and are eliminated through apoptosis. Tissue remodeling results in a structure that resembles the gland of a nulliparous female. Proliferation and differentiation of the mammary gland is regulated by the interplay of cell-substratum and cell-cell interactions, growth factors, and peptide and steroid hormones (for review, see Ref. 1).

The HC11 cell line originated from mammary gland tissue of a mid-pregnancy BALB/c mouse (2). It is an excellent model system for studying differentiation states of mammary epithelial cells. These cells retain important characteristics of normal mammary epithelial cells, e.g. they synthesize the milk protein ß-casein in vitro upon treatment with lactogenic hormones (2, 3) and normal duct morphogenesis when injected into the cleared fat pad of syngeneic mice (3, 4).1 A crucial event in the mammary epithelial cells is the activation of the epidermal growth factor (EGF)2 receptor during the growth phase. In HC11 cells, activation of the EGF receptor promotes growth and confers competence to the cells to respond to the lactogenic hormones while inhibiting differentiation (5). After removal of EGF, differentiation of HC11 cells in vitro can be induced by the synergistic actions of insulin, glucocorticoids, and prolactin (6). Despite the enormous progress made in the past few years in the elucidation of the signal transduction pathways controlling development of the mammary gland epithelium (for review, see Ref. 7), the molecular machinery governing the switch from proliferation to differentiation has only been described in a rudimentary fashion. Several groups have investigated protein expression patterns of normal or cancer mammary epithelial cells (812), but no data is available about the changes in protein expression that accompany mammary epithelial cell differentiation.

Therefore, we have used a systematic approach to study the patterns of proteins whose expression varies upon the differentiation of HC11 cells. This approach provided new insights into the proteins involved in mammary epithelial cell differentiation.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—
HC11 cells were grown in RPMI 1640 medium containing 10% fetal calf serum, 5 µg/ml insulin, and 10 ng/ml EGF, 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin. To promote differentiation, the cells were first rendered competent for hormonal induction by cultivation in medium lacking insulin for 4 days after reaching confluency. Subsequently the cells were induced by incubation for 4 days in a medium containing 1 µM dexamethasone (Sigma), 5 µg/ml insulin, and 5 µg/ml prolactin (Sigma). Differentiation was monitored by following the formation of blister-like structures or "domes" that appear in confluent cultures and are thought to result from fluid secretion and by detection of ß-casein expression (2, 3).

High Resolution Two-dimensional Gel Electrophoresis—
HC11 cells were suspended in ice-cold lysis buffer (4 M urea, 50 mM HEPES, 5 mM EDTA, 10 mM Mg2SO4, pH 8.5) supplemented with protease inhibitors and were disrupted by sonication. Lysates were cleared of nucleic acids by treatment with Benzonase® (Merck, 5,000 units/g of cells) for 90 min at 4 °C. Cell debris and remaining intact cells were removed by centrifugation for 15 min at 20,000 x g and 4 °C. Total proteins were precipitated with trichloroacetic acid and solubilized in a sample solution containing 6 M urea, 2 M thiourea, 4% (w/v) CHAPS, 75 mM dithiothreitol, 0.5 mM EDTA, 5 mM Pefabloc, 0.01% (v/v) Orange G, 1% (v/v) Ampholines, pH 3.5–9.5 (Amersham Biosciences), and 1% (v/v) Pharmalytes, pH 3–10 (Amersham Biosciences). Immobilized pH gradient strips (18 cm, pH 4–7 linear (Xzillion) or 6–11 linear (Amersham Biosciences)) were rehydrated overnight with sample solution omitting the protein sample. Subsequently, samples were applied to the immobilized pH gradient strips by cup loading. Isoelectric focusing of the first dimension was then performed for ~78,000 Volt hours at 17 °C. The equipment for running of the immobilized pH gradient strips (IPGPhor) was purchased from Amersham Biosciences. In the second dimension, proteins were separated according to their molecular mass using 12% SDS-PAGE gels (19 x 23 cm) run at 10 °C with a DALT-1 electrophoresis apparatus (Amersham Biosciences) set at 1000 milliampere hours per gel.

Four analytical gels (150 µg of proteins) were run for each sample. They were silver-stained for protein pattern analysis as described previously (13), except that glutardialdehyde was omitted from the sensitizing solution. Preparative gels (600 µg of proteins), loaded with extracts from undifferentiated (pI 4–7) or differentiated (pI 6.5–11) HC11 cells, were stained with Coomassie Blue (14) for mass spectrometry analysis.

Analysis of 2-D Gel Spot Patterns—
To obtain significant measurements of protein expression, we ran four replicate analytical gels for each experimental condition. The replicates were scanned with standardized parameters using a high sensitivity flatbed scanner (ImageScanner, Amersham Biosciences), and scanned gel images were processed by the Proteomics Software SystemTM (PSS) developed by Xzillion (Frankfurt am Main, Germany). A master gel was computed by registering and jointly segmenting the multiple registered replicates; for algorithmic details refer to Baker et al. (15). Spot volumes were determined by modeling the optical density in individual spot segments by a two-dimensional Gaussian analysis. A spot was considered only if detected in at least 50% of the replicates (i.e. each spot was present in two or more of the four replicates). Comparative analysis was undertaken by matching master gels of reference and test samples in a semiautomatic manner. First, an automatic algorithm that solves the point-matching problem for two sets of spot coordinates was applied; for algorithmic details see Gold et al. (16). Subsequent manual editing of the automatic matching refined the results. Differential expression was assessed by calculation of the spot {Delta} volumes, representing the ratio between the volume of a spot in the test gel (differentiated cells) and the volume of this spot in the reference gel (undifferentiated cells). Spots were considered significantly up- (or down-) regulated if the corresponding volumes showed an increase (or decrease) by a factor of >=2 when comparing reference to test gels. Thereafter, analytical and preparative gels were matched as described above, and a list of spot coordinates was generated for subsequent analysis.

Protein Isolation and Digestion—
The protein spots of interest were excised from the preparative 2-D gels, washed, and digested with trypsin. They were analyzed in a fully automatic manner on a spot-handling platform (Ettan spot-handling platform, Amersham Biosciences) according to the manufacturer’s instructions.

Protein Identification by Matrix-assisted Laser Desorption/Ionization Mass Spectrometry Analysis—
Mass spectra of the tryptic digests were derived on a Voyager STR (Applied Biosystems) matrix-assisted laser desorption/ionization time-of-flight mass spectrometer equipped with delayed extraction (17). 0.5 µl of each analyte solution was allowed to dry, and 0.5 µl of matrix solution (10 g/liter {alpha}-cyano-4-hydroxycinnamic acid in 49.9% water/49.9% acetonitrile/0.2% trifluoroacetic acid) was added. After a two-point calibration, the mass accuracy was in most cases better than 10 ppm ({Delta}m/m); therefore, the mass tolerance was set to 15 ppm. A mass list of peptides was obtained for each protein digest. This peptide mass fingerprint was then submitted to an appropriate software to perform database searches and identify the proteins (MS Fit, Applied Biosystems).

Western Blot Analysis—
Cells were harvested in ice-cold lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40, and protease and phosphatase inhibitors). Extracts were incubated for 15 min on ice, and cellular debris was removed by centrifugation for 15 min at 12,000 x g. Protein concentrations were determined by Bradford. Equal amounts of proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes. Blots were stained with Ponceau S to visualize loaded proteins, and immunodetection was performed using specific antibodies. ß-Casein-specific antiserum was a kind gift from Itamar Barash (Bet Dagan, Israel). Antiannexin I was from Zymed Laboratories Inc.. Antibodies against Hsp27, the receptor for activated C kinases (RACK1), proliferating cell nuclear antigen (PCNA), and T-complex protein 1 {alpha} (TCP-1-{alpha}) were from Santa Cruz Biotechnology, Inc.

Real Time Quantitative Reverse Transcription-PCRs—
Total RNA from undifferentiated HC11 cells and HC11 cells that had been induced to differentiate for 1 day was prepared using peqGOLD TriFastTM (peqLab Biotechnology, Erlangen, Germany) following the manufacturer’s instructions. RNA was reverse transcribed at 42 °C for 1 h using avian myeloblastosis virus reverse transcriptase (Invitrogen). The PCR reactions were performed in an iCycler (Bio-Rad) with 5 µl of the cDNA diluted 1:5 or 1:50, 100 pmol of primers, 12.5 nmol of dNTPs, SYBR Green (Bio-Rad), and 2.5 units of AmpliTaq® DNA polymerase (PerkinElmer Life Sciences) in a 50-µl reaction. The PCR primers used were as follows: annexin I sense, GCAAAGGCAGACGAGCAG; annexin I antisense, CTTCACCCCGGCATCATAGAG; TCP-1-{alpha} sense, CTGGTGCCATGGCTGTTAGGAGA; TCP-1-{alpha} antisense, CAAATTGGCCAGCGTAGACAGGA; HSP27 sense, CAAGGAAGGCGTGGTGGAGAT; HSP27 antisense, ACCTGGAGGGAGCGTGTATTT; PCNA sense, AGAGGAGGCGGTAACCATAGAGAT; PCNA antisense, TAGGAGACAGTGGAGTGGCTTTTG; RACK1 sense, GAATGGGTGTCTTGTGTCC; RACK1 antisense, CTTGCAGTTAGCCAGATTC; ß-casein sense, TCACTCCAGCATCCAGTCACA; ß-casein antisense, GGCCCAAGAGATGGCACCA; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sense, GATGACATCAAGAAGGTGGTG; and GAPDH antisense, GCTGTAGCCAAATTCGTTGTC.

Relative quantification of the PCR products was performed by comparing the threshold cycle (Ct) of different samples. Ct was defined as the fractional cycle number at which the amount of amplified target reached a fixed threshold. The Ct value correlated with input target mRNA levels, and a lower Ct value indicated a higher starting copy number. It is assumed that a difference of one cycle in the linear phase of the reaction corresponds to a 2-fold difference in transcript levels between samples.

Rhodamine-Phalloidin Staining of Cellular Actin—
Cells were left undifferentiated or induced to differentiate for 4 days, fixed with formaldehyde, and stained with phalloidin-tetramethylrhodamine ß-isothiocyanate (TRITC) conjugate (Sigma) to visualize actin as described previously (18).


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Differentiation of HC11 Mammary Epithelial Cells in Vitro and Identification of Stage Specifically Expressed Proteins by Two-dimensional Gel Electrophoresis and Mass Spectrometry
We studied the pattern of proteins expressed at different stages of mammary epithelial cell differentiation. For this purpose, HC11 cells were maintained under proliferative conditions (undifferentiated) or induced to differentiate in the presence of lactogenic hormones (dexamethasone, insulin, and prolactin) for 4 days. The appearance of blister-like structures or domes and the induction of ß-casein gene expression indicated the differentiated state (Fig. 1).



View larger version (89K):
[in this window]
[in a new window]
 
FIG. 1. Differentiation of HC11 mammary epithelial cells. HC11 cells were grown as described under "Experimental Procedures," and differentiation was induced by incubation of confluent cells for 4 days in a medium containing 1 µM dexamethasone, 5 µg/ml insulin, and 5 µg/ml prolactin. Differentiation was monitored by following morphological changes (A) and detecting ß-casein expression by Western blot (B). Arrows indicate the presence of domes. U, undifferentiated; D, differentiated.

 
Total cell extracts from proliferating and differentiated HC11 cells were prepared and loaded onto 2-D gels. After electrophoresis, the gels were stained with Coomassie Blue, and all visible spots were excised and processed for mass spectrometric analyses. The corresponding proteins were identified by peptide mass fingerprinting and computer analysis. To identify proteins whose expression varies in the two differentiation states, we computed master gels from scanned gel images of four replicate analytical silver-stained gels. The comparison of master gels from proliferating versus differentiated cells allowed the recognition of differentially regulated proteins. To correct for variability due to gel electrophoresis, four replicate analytical gels were run for each experimental condition. We also disregarded spots that were expressed in less than 50% of the replicate gels. Furthermore, proteins were considered to be significantly up- or down-regulated when the corresponding spot volumes showed an increase or decrease by a factor of at least two when spots from differentiated and proliferating cells were compared. Representative master gels displaying proteins expressed in undifferentiated and differentiated HC11 cells (pI 4–7) are shown, and those protein spots that are differentially expressed are annotated (Figs. 2 and 3).



View larger version (70K):
[in this window]
[in a new window]
 
FIG. 2. Representative silver-stained 2-D gels loaded with extracts of undifferentiated (A) and differentiated (B) HC11 cells. Spots that are differentially expressed are annotated.

 


View larger version (45K):
[in this window]
[in a new window]
 
FIG. 3. Examples of proteins regulated during differentiation of mammary epithelial cells. Representative parts of the 2-D gels of the proteome of HC11 cells are depicted, showing expression of selected proteins during differentiation. Numbers represent normalized {Delta} spot volumes (see Table I). U, undifferentiated; D, differentiated.

 
Accordingly, 102 proteins were identified on preparative Coomassie gels and matched with spots in analytical silver-stained gels. The proteins varied between 10 and 90 kDa in size with pI values ranging from 4.0 to ~11.0. Among them, around 60 proteins increased or decreased during differentiation (Tables I and II). It should be noted that the gel system used in these experiments did not allow simultaneous separation of acidic and basic proteins. Two preparative 2-D gels were used for spot isolation and mass spectrometric identification of proteins. They displayed spots of pI 4–7 or pI 6.5–11 and were loaded with extracts from undifferentiated and differentiated cells, respectively. Therefore, we could not identify basic proteins (pI >7) exclusive for the undifferentiated state and acidic proteins (pI <6.5) exclusive for the differentiated state. This is the case, for example, for ß-casein, an acidic protein (pI {approx}5) expressed specifically in differentiated mammary epithelial cells (Fig. 1).


View this table:
[in this window]
[in a new window]
 
TABLE I List of protein spots whose expression changes during differentiation

D indicates a spot that is exclusively present in differentiated cells, and U indicates a spot that is exclusively present in undifferentiated cells.

 

View this table:
[in this window]
[in a new window]
 
TABLE II List of protein spots whose expression does not change during differentiation

 
Functional Groups of Regulated Proteins
The analysis of proteins regulated during the differentiation of HC11 cells led to the clustering of proteins involved in particular cellular functions (Fig. 4). The proteins with the greatest difference in expression were cytoskeletal components, molecular chaperones and regulators of protein folding and stability, calcium-binding proteins, components of RNA-processing pathways, and regulators of cellular metabolism.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. Clustering of regulated proteins according to their function. Proteins acting in the same pathway with similar activities or functions are shown. The values above each bar represent spot numbers; for annotation of proteins, see Table I. The spots detected exclusively either in undifferentiated cells or in differentiated cells were arbitrarily set to -15 and +15, respectively.

 
Chaperones and Cytoskeletal Proteins—
Interestingly, approximately equal numbers of cytoskeletal proteins were either up-regulated or repressed during HC11 cell differentiation. There was preferential expression of regulators of protein folding and stability, such as chaperones, disulfide isomerase, and a subunit of the proteasome, in undifferentiated cells. Strikingly, different subunits of the TCP-1 chaperone required for folding of actin and tubulin (19) were conversely regulated. While TCP-1-{alpha} (Table I, spot 240) was down-regulated, TCP-1-{tau} (spot 263) was up-regulated during differentiation of HC11 cells. Members of the HSP70 (GRP78, spots 163 and 166; Hsc71, spots 177, 179, and 181; and HSP70, spot 183), HSP60 (HSP60, spots 262, 269, and 270), and the small HSP (HSP27, spot 781) families of heat shock proteins were expressed preferentially in undifferentiated cells. They function as molecular chaperones by binding to a substrate protein and facilitating its correct folding in vivo (for review, see Ref. 20). Increasing evidence suggests that besides the TCP-1 complex, the HSP family of chaperones may play a role in the formation and function of the cytoskeleton (19). These data suggest that significant reorganization of the cytoskeleton accompanies mammary epithelial cell differentiation.

Proteasomal Proteins—
Expression of two subunits of the proteasome was inversely regulated during HC11 differentiation. The proteasome is the major proteolytic complex of eukaryotic cells, primarily essential for degradation of polyubiquitinated proteins. It consists of a 20 S proteolytic core particle and a 19 S regulatory particle responsible for recognition of ubiquitinated substrates (21). The 20 S proteolytic core can also associate with complexes other than the 19 S particle (2124); however, the physiological significance of these interactions is not clear. Our data show that S5a, a component of the 19 S complex, is down-regulated (spot 374), whereas another subunit of the proteasome, subunit ß type 2 (spot 448), is up-regulated after HC11 differentiation. The proteasome has been implicated in the proteolysis of transcription factors, cell cycle regulatory proteins, oncogenes, tumor suppressors, and proteins involved in cellular differentiation (2528). The rapid degradation of certain regulatory proteins is important in the stringent control of their signaling activity (25, 26). Our results suggest that activity of the proteasome may be modulated by differential expression of specific subunit components during mammary epithelial cell differentiation.

Calcium-binding Proteins—
Two families of calcium-binding proteins were highly regulated during differentiation of HC11 cells: calmodulin and annexins. These proteins are involved in many cellular processes, and binding to calcium regulates their activity. Annexins are phospholipid-binding proteins that may cross-link plasma membrane phospholipids, actin, and the cytoskeleton (29) to regulate proliferation (30), exocytosis (31), and membrane fusion (32). Annexin I expression correlates with cell proliferation (30, 33), and its overexpression blocks intracellular calcium release and inhibits cell adhesion and differentiation (34). Conversely, annexin II levels are 32-fold higher in PC-12 cells that cease proliferation and undergo reversible differentiation into non-dividing neuron-like cells in response to nerve growth factor (30). We also found a strong up-regulation of annexin II levels in differentiated HC11 cells (spots 280 and 294). It is believed that annexin II plays a role in exocytosis (31). The up-regulation of annexin II in differentiated HC11 cells suggests that this protein might play a role in the secretion of milk constituents. This is in agreement with the studies of Handel et al. (35), who detected annexin II associated with secretory vesicles at the apical membrane of actively secreting mammary epithelial cells. We found an up-regulation of annexin I in differentiated HC11 cells. This is not in agreement with a previously assigned role of annexin I in proliferation. However, we identified two spots containing annexin I, only one of which was up-regulated in differentiated cells (Table I, spot 264, and data not shown). It is therefore possible that a post-translational modification of annexin I might accompany a functional modification. Together, these results suggest a role for calcium in differentiation of mammary epithelial cells, probably through regulation of the actin cytoskeleton and exocytosis.

Regulators of Intracellular Signaling—
Our data present the first indication for a role of 14-3-3 {zeta} and RACK1 in mammary gland differentiation. Expression of these two extracellular signaling proteins is inversely regulated during HC11 cell differentiation. We found higher expression of 14-3-3 {zeta} (spot 749) in undifferentiated cells. 14-3-3 {zeta} belongs to a family of highly conserved and abundant proteins found throughout the eukaryotic kingdom. They exist in multiple isoforms and have been implicated as key regulators of diverse cellular processes such as signal transduction, cell cycle control, apoptosis, stress response, and malignant transformation. They mediate their effects through binding to phosphoserine-containing sequence motifs in diverse partners, thereby acting as (1) adaptor molecules stimulating protein-protein interactions, (2) regulators of subcellular localization of proteins, and (3) activators or inhibitors of enzymes (for review, see Ref. 36). 14-3-3 {sigma}, and not 14-3-3 {alpha}/ß or {delta}/{zeta}, is strongly down-regulated in breast cancer cells (11, 12), suggesting that each isoform might have a distinct function. In contrast to 14-3-3 {zeta}, we measured a 5-fold increase in expression of RACK1 (spot 345) after differentiation of HC11 cells. RACK1 is an adaptor molecule that binds only the activated form of protein kinase C, directing the localization of the activated enzymes to distinct cellular compartments (37). In addition to anchoring activated protein kinase C isozymes, RACK1 anchors other signaling enzymes, including Src tyrosine kinase (38), Fyn (39), and phosphodiesterase (40), and associates with integrins (41), type I interferon (42), and insulin-like growth factor I receptors (43). Interestingly, it was recently demonstrated that RACK1, by recruiting Stat1 to the type I interferon receptor, plays an essential role in signaling through the Jak-Stat pathway (42). Signaling through the Jak-Stat pathway controls epithelial differentiation throughout development of the mammary gland (44), and it is likely that RACK1 is also essential for differentiation of the mammary epithelium. Furthermore, RACK1 seems to favor cellular differentiation by inhibiting progression of the cell cycle (38) and mediating cell spreading and contact with extracellular matrix via integrin and focal adhesion molecules (43). This, together with the strong induction of RACK1 that we detected in extracts from the differentiated HC11 cells, suggests that RACK1 might be a major player in the differentiation of mammary epithelial cells, probably by regulating multiple signaling pathways.

Regulators of Transcription and RNA Processing—
Two transcription factors were identified that exhibit an opposed expression pattern during differentiation. PCNA is a component of the replication and DNA repair machinery and a known marker of cellular proliferation (45). We found that PCNA (spot 655) levels are greatly elevated in undifferentiated cells, which correlates well with the proliferating state of these cells. Conversely, the CArG box-binding factor-A (CBF-A, spot 248) was found to be expressed exclusively in differentiated cells. This protein was originally identified as a transcriptional repressor (46, 47) and has also been shown to activate transcription of the Ha-ras gene (48). In addition, CBF-A belongs to the family of heterogeneous nuclear ribonucleoproteins (hnRNPs) that bind pre-mRNAs (46). Indeed, increased expression of CBF-A results in enhanced stability of target mRNAs (49). Thus, CBF-A acts both on transcriptional and post-transcriptional processes in gene expression.

In addition to the effects on CBF-A, differentiation had an effect on the expression of a wide range of proteins controlling RNA processing. Proteins functioning in nearly every step of RNA processing were found to be regulated: transcription (CBF-A), pre-mRNA splicing (hnRNP F, spot 149; K, spot 259; A1, spot 421; and A2/B1, spots 275, 306, and 348), nuclear export (Ran/TC4, spots 405 and 408, and hnRNP arginine N-methyltransferase (50), spot 267), stability (CBF-A), translation (eIF-4A, spot 443, and tRNA methyltransferase, spot 374), and localization (MARTA1 (51), spot 53). These data suggest interesting possibilities for a role of mRNA maturation, export, and localization in mammary epithelial cell differentiation.

Glycolytic Proteins—
A very striking feature of the differentiated cells was the high induction of proteins involved in the glycolytic pathway, e.g. in the conversion of glucose to pyruvate (aldolase A, spot 248; phosphoglycerate kinase 1, spot 207; phosphoglycerate mutase, spot 381; GAPDH, spots 260 and 270; and pyruvate kinase, spot 101). A similar observation was made in mammary tumor models (52), where it probably reflects accelerated rates of metabolism. Activation of the glycolytic pathway ultimately serves the synthesis of ATP. Differentiated mammary epithelial cells, whose function is to constantly secrete milk proteins and lipids into the ducts of the gland, require energy for this polarized secretion. Therefore, it seems reasonable that these cells activate the glycolytic pathway to support their need for energy. Alternatively, enzymes of this pathway might play a role in differentiation. For example, decrease in pyruvate kinase activity has been shown to correlate with differentiation of trypanosomes (53) and mouse embryonal carcinoma cells (54, 55). On the other hand, expression of this enzyme increases during differentiation of neuronal cells (56).

Extracellular Matrix—
We also found regulated expression of an enzyme controlling extracellular matrix composition; undifferentiated cells displayed a 2-fold increased expression of hyaluronan synthase 3 (spot 84). Hyaluronan synthases 1, 2, and 3 are responsible for the production of hyaluronan, a component of extracellular and cell-associated matrices essential for growth and motility (57, 58). Interestingly, hyaluronan is essential for ductal branching of the prostate gland epithelium (59). This and the regulation of hyaluronan synthase expression during differentiation of HC11 cells suggest that hyaluronan might be important for differentiation of mammary epithelial cells. However, overproduction of hyaluronan is thought to be directly involved in tumorigenesis and metastasis. Increased levels of hyaluronan in urine and serum are often associated with advanced cancers (60, 61). Presumably, hyaluronan promotes tumor growth by stimulating intrinsic cell growth rates and angiogenesis (62, 63) and promoting metastasis (64). Together, our data suggest that hyaluronan synthases play a role in the normal development of the mammary gland and that their deregulated expression might contribute to the development of breast cancer.

Validation of the Observed Protein Expression Profiles and Fluorescence Microscopy
To confirm some of the changes in protein expression during differentiation, we performed Western blot and quantitative PCR analyses for some differentially expressed proteins. As expected, while the protein levels of annexin I and RACK1 increased with differentiation, TCP-1-{alpha}, heat shock protein 27, and PCNA were expressed preferentially in proliferating cells (Fig. 5A). Interestingly, two isoforms of annexin I were visualized on Western blots (Fig. 5A) and on the 2-D gels (data not shown). Presence of two isoforms might indicate that this protein is subject to post-translational modification during differentiation. The changes in protein expression did not always correlate with mRNA levels (Fig. 5B). In some cases, including annexin I, RACK1, and GAPDH, we observed no variation in mRNA amounts, or even opposite regulation of the mRNA. These results indicate that many of the changes that accompany differentiation of mammary epithelial cells occur at the translational or post-translational level.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 5. Validation of the 2-D gel electrophoresis data by Western blot and quantitative PCR. HC11 cells were maintained in proliferative conditions (U) or induced to differentiate for 4 days (D). Expression of annexin I, TCP-1-{alpha}, HSP27, PCNA, and RACK1 in the cell extracts was monitored by Western blot using specific antibodies (A), or total RNA was extracted and the expression of the indicated genes assessed by quantitative reverse transcription-PCR (B). {Delta}Ct, Ct (differentiated sample) - Ct (undifferentiated sample).

 
Expression of many cytoskeletal components was found to be regulated during the differentiation of HC11 cells, suggesting a rearrangement of the cytoskeleton. To test this, we examined whether differentiation affected the distribution of the actin cytoskeleton. HC11 cells were maintained under proliferative conditions or induced to differentiate, and the cells were fixed and stained with TRITC-phalloidin to visualize F-actin (Fig. 6). In undifferentiated HC11 cells, actin staining revealed the presence of contractile actin filaments (stress fibers) across the cells and at sites of focal adhesion. This pattern of staining is typical of cells activated by extracellular growth factors (65). Two distinct patterns of actin distribution were observed in differentiated HC11 cells. The presence of these two patterns correlates with the emergence of two phenotypically distinguishable populations of cells after differentiation (data not shown). One population exhibited a similar actin distribution as undifferentiated HC11 cells, whereas the other displayed a totally different organization of the actin cytoskeleton. In this case, actin was concentrated just underneath the plasma membrane, forming a ring-like structure around the cell (Fig. 6). A similar pattern was observed upon staining the cell adhesion molecule E-cadherin (data not shown). This molecule is a component of adherens junctions in terminally differentiated epithelium. Thus, relocalization of actin at the sites of cell-cell contacts in differentiated cells confirms our proteomics data, which indicates that differentiation is accompanied by reorganization of the actin cytoskeleton.



View larger version (132K):
[in this window]
[in a new window]
 
FIG. 6. Reorganization of the actin cytoskeleton upon differentiation of mammary epithelial cells. Undifferentiated HC11 cells and HC11 cells that have been induced to differentiate for 4 days were fixed, stained for actin with TRITC-phalloidin, and observed by fluorescence microscopy.

 

    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We applied high resolution 2-D gel electrophoresis and the identification of proteins by mass spectrometry to the analysis of changes in the proteome accompanying the differentiation of mammary epithelial cells. In the present study, we identified about 60 proteins whose expression varied between the undifferentiated and the functionally differentiated state of HC11 mammary epithelial cells.

Several of these proteins are expected to be regulated in polarized mammary epithelial cells that depend upon vesicle movement along cytoskeletal elements to achieve secretion of milk components. Among these are actin-binding proteins, chaperones, a subunit of a microtubule motor complex, and proteins regulating aggregation and fusion of vesicles. Remarkably, differentiation of HC11 cells also resulted in the induction of a series of proteins involved in mRNA processing, localization, and translation. Regulation of several of these proteins was corroborated by different experimental approaches, including 2-D gel electrophoresis, Western blotting, and fluorescence microscopy, and allowed us to propose new concepts regarding mammary epithelial cell differentiation.

Cellular differentiation, generally associated with phenotypic modifications of the cell, often involves reorganization of the actin cytoskeleton (66). Microscopic observation of mouse mammary glands indicated that differentiated cells have an increased cell size and undergo changes in cell shape and polarization (67). The acquisition of apical basal polarity is apparent, for example, at the final step of differentiation, during lactation when milk proteins are secreted through the luminal side of mammary alveolar cells. Cell polarization is a complex phenomenon dependent on rearrangement of the actin cytoskeleton (68, 69).

Vectorial secretion of vesicles also depends on actin-based motility (70). Secretory vesicles containing milk proteins require transport on microtubules. Once they reach the apical plasma membrane, local reorganization of actin and activity of specialized proteins might allow fusion and exocytosis. In undifferentiated HC11 cells, we found the presence of actin stress fibers throughout the cells. In differentiated cells, however, actin was concentrated at the plasma membrane, where exocytosis occurs. In addition, these cells exhibit increased expression of proteins involved in exocytosis, for example, a protein showing similarity to dynactin 2, a subunit of the dynactin macromolecular complex and annexin II. Dynactin binds to dynein, a biological motor protein that provides a force for intracellular motility of organelles and vesicles along microtubules (71). Annexin II is a protein that links the plasma membrane to the cytoskeleton in a calcium-dependent manner and whose importance for exocytosis has been documented (7274). The remodeling of the actin cytoskeleton in parallel with the up-regulation of the microtubule motor protein dynactin 2 and annexin II is consistent with the acquisition of secretory functions in differentiated HC11 cells.

The importance of actin rearrangements during mammary gland development was demonstrated by analysis of gelsolin-deficient mice. Gelsolin is the founding member of a family of actin-binding proteins involved in controlling the organization of the actin cytoskeleton in cells (for review, see Ref. 75). Gelsolin severs actin filaments in the presence of submicromolar amounts of calcium, thereby disassembling the actin network. Although embryonic development and longevity were normal in mice lacking gelsolin, migration of neutrophils and dermal fibroblasts was decreased (76), indicating that gelsolin is required for rapid motile responses in some cell types, such as those involved in hemostasis, inflammation, and wound healing. In addition, lack of gelsolin resulted in defects in mammary gland development. Some mice exhibited only rudimentary structures until 9 weeks of age, whereas all female adults had no terminal branching and displayed delayed alveolar development during pregnancy. These defects were only transient as lactation and involution were normal (77). The requirement of gelsolin for ductal development of the mammary epithelium is not surprising. Gelsolin mediates EGF effects on cell motility (78), and EGF controls ductal outgrowth, elongation, and branching (for review, see Ref. 1). We detected enhanced expression of gelsolin in undifferentiated HC11 cells. This supports the notion that gelsolin is required during early development of the mammary gland.

HSP27 is also part of a signaling pathway regulating the dynamics of actin filaments (79). This protein was found to be more abundant in undifferentiated cells. Interestingly, HSP27 has been shown to be essential for the differentiation of mouse embryonic stem cells (80). The existence of stem cells has also been demonstrated in the mammary epithelium (81, 82), and the HC11 cell line maintains stem cell properties as it can recapitulate normal duct morphogenesis upon transplantation into the cleared fat pad of mice (4). The fact that expression of HSP27 varies upon differentiation of HC11 cells suggests that it is also involved in differentiation of mammary epithelial cells and that signaling pathways governing differentiation might be conserved between embryonic and adult stem cells. Proteomics analysis found that proteins preferentially expressed in undifferentiated HC11 cells are also increased in expression in mammary tumor samples. These include HSP27, GRP78, protein disulfide isomerase, HSP60, and PCNA (10, 11, 83, 84). High expression of these proteins in the undifferentiated cells is not surprising and might be associated with proliferation.

RNA-interacting proteins were found to be a major class of proteins regulated during differentiation of HC11 cells. This suggests that post-transcriptional control of gene expression might play a central role in mammary epithelial cell differentiation. This is consistent with observations in which the induction of lactogenic hormones has been described to induce a factor responsible for post-transcriptional stabilization of ß-casein mRNA (85, 86). Moreover, we have identified previously a cellular factor that represses the transcription of the ß-casein gene and that, during lactation of animals and after lactogenic hormone induction of HC11 cells in culture, bound to the ß-casein RNA and remained sequestered in the cytoplasm (87). CBF-A, a factor identified to be differentially regulated in our screen, also seems to possess this dual ability to control transcription (4648) and to be able to bind to RNA (46, 49). The regulated expression of CBF-A during mammary epithelial cell differentiation might result in controlled stability of target mRNAs.

Another means of post-transcriptional control of gene expression consists of the regulation of mRNA subcellular localization. Asymmetric intracellular distribution of specific mRNAs can generate cell polarity by controlling translation sites and by restricting particular proteins to specific subcellular compartments (88, 89). For example, the localization of ß-actin mRNA has been shown to be asymmetric (9092) depending on the activity of a splicing regulatory protein (93). Interestingly, this splicing factor is homologous to MARTA1, isolated as a protein interacting with microtubule-associated protein 2 (MAP2) mRNAs (51), which is targeted to dendrites in neuronal cells (94). We observed up-regulation of a protein homologous to rat MARTA1 in differentiated HC11 cells, suggesting that regulation of mRNA localization might occur during mammary epithelial cell differentiation and contribute to the establishment of cellular polarity.

About 80% of the protein species identified in the mouse mammary gland differ in their theoretical Mr and pI values as a result of post-translational modifications (8). Accordingly, many of the proteins that we have identified migrated on the 2-D gels as several spots that were differently regulated (see Tables I and II). For example, 9 spots were identified for hnRNPA2/B1, and among them 3 were up-regulated during differentiation. This suggests that the different protein isoforms might have distinct roles during differentiation.

The comparative analysis of protein expression patterns from the two stages of mammary epithelial cell differentiation yielded interesting and interpretable results. This analysis, however, cannot be considered comprehensive. There are experimental limitations that have to be kept in mind. Even the sophisticated protein separation and identification methods used only allow the analysis of a subset of proteins. Proteins outside the pH range of the isoelectric focusing procedure or proteins expressed at low levels might escape detection. In addition, the HC11 cell line is certainly a valuable and suitable experimental model but does not necessarily reflect the entire complexity of the in vivo situation. The lactogenic hormone-induced pattern of protein expression we observed in our experiments represents the state of fully differentiated mammary epithelial cells. It does not account for proteins that are involved in the early steps of mammary epithelial cell differentiation. Although it is known that the Jak-Stat signaling pathway plays major roles in the development of the mammary gland epithelium (for review, see Ref. 44), the molecular machinery governing the switch from proliferation to differentiation in these cells is poorly understood. Experiments in which we try to account for these limitations, e.g. the use of HC11 cells hormonally induced for different time periods or the analysis of subcellular fractions, might provide further insights into the signaling pathways and functional differentiation processes underlying mammary gland development.


    ACKNOWLEDGMENTS
 
We thank Nadine Böcher and Melanie Gläser for excellent technical assistance and Dr. Marco Schärfke for help with bioinformatics.


    FOOTNOTES
 
Received, April 8, 2003, and in revised form, July 24, 2003.

Published, MCP Papers in Press, July 28, 2003, DOI 10.1074/mcp.M300032-MCP200

1 S. Desrivières and B. Groner, unpublished observations. Back

2 The abbreviations used are: EGF, epidermal growth factor; CBF-A, CArG box-binding factor-A; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 2-D, two-dimensional; hnRNP, heterogeneous nuclear ribonucleoprotein; Hsp, heat shock protein; Ct, threshold cycle; PCNA, proliferating cell nuclear antigen; RACK-1, receptor for activated C kinases; TCP-1, T-complex protein 1; TRITC, tetramethylrhodamine ß-isothiocyanate; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid. Back

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Present address: Ciphergen Biosystems GmbH, Hannah-Vogt Strasse 1, D-37085 Göttingen, Germany. Back

|| Present address: Dept. of Biological Sciences, 2500 University Dr. N.W., Calgary, Alberta, Canada. Back

** Both authors contributed equally to this work. Back

{ddagger}{ddagger} To whom correspondence should be addressed. Tel.: 49-069-633-95183; Fax: 49-069-633-95185; E-mail: Groner{at}em.uni-frankfurt.de


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hennighausen, L., and Robinson, G. W. (2001) Signaling pathways in mammary gland development. Dev. Cell 1, 467 –475[CrossRef][Medline]

  2. Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppler, W., and Groner, B. (1988) Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 7, 2089 –2095[Medline]

  3. Danielson, K. G., Oborn, C. J., Durban, E. M., Butel, J. S., and Medina, D. (1984) Epithelial mouse mammary cell line exhibiting normal morphogenesis in vivo and functional differentiation in vitro. Proc. Natl. Acad. Sci. U. S. A. 81, 3756 –3760[Abstract/Free Full Text]

  4. Humphreys, R. C., and Rosen, J. M. (1997) Stably transfected HC11 cells provide an in vitro and in vivo model system for studying Wnt gene function. Cell Growth & Differ. 8, 839 –849[Abstract]

  5. Taverna, D., Groner, B., and Hynes, N. E. (1991) Epidermal growth factor receptor, platelet-derived growth factor receptor, and c-erbB-2 receptor activation all promote growth but have distinctive effects upon mouse mammary epithelial cell differentiation. Cell Growth & Differ. 2, 145 –154[Abstract]

  6. Topper, Y. J., and Freeman, C. S. (1980) Multiple hormone interactions in the developmental biology of the mammary gland. Physiol. Rev. 60, 1049 –1106[Free Full Text]

  7. Rosen, J. M., Wyszomierski, S. L., and Hadsell, D. (1999) Regulation of milk protein gene expression. Annu. Rev. Nutr. 19, 407 –436[CrossRef][Medline]

  8. Aksu, S., Scheler, C., Focks, N., Leenders, F., Theuring, F., Salnikow, J., and Jungblut, P. R. (2002) An iterative calibration method with prediction of post-translational modifications for the construction of a two-dimensional electrophoresis database of mouse mammary gland proteins. Proteomics 2, 1452 –1463[CrossRef][Medline]

  9. Page, M. J., Amess, B., Townsend, R. R., Parekh, R., Herath, A., Brusten, L., Zvelebil, M. J., Stein, R. C., Waterfield, M. D., Davies, S. C., and O’Hare, M. J. (1999) Proteomic definition of normal human luminal and myoepithelial breast cells purified from reduction mammoplasties. Proc. Natl. Acad. Sci. U. S. A. 96, 12589 –12594[Abstract/Free Full Text]

  10. Bini, L., Magi, B., Marzocchi, B., Arcuri, F., Tripodi, S., Cintorino, M., Sanchez, J. C., Frutiger, S., Hughes, G., Pallini, V., Hochstrasser, D. F., and Tosi, P. (1997) Protein expression profiles in human breast ductal carcinoma and histologically normal tissue. Electrophoresis 18, 2832 –2841[CrossRef][Medline]

  11. Rui, Z., Jian-Guo, J., Yuan-Peng, T., Hai, P., and Bing-Gen, R. (2003) Use of serological proteomic methods to find biomarkers associated with breast cancer. Proteomics 3, 433 –439[CrossRef][Medline]

  12. Vercoutter-Edouart, A. S., Lemoine, J., Le Bourhis, X., Louis, H., Boilly, B., Nurcombe, V., Revillion, F., Peyrat, J. P., and Hondermarck, H. (2001) Proteomic analysis reveals that 14-3-3sigma is down-regulated in human breast cancer cells. Cancer Res. 61, 76 –80[Abstract/Free Full Text]

  13. Heukeshoven, J., and Dernick, R. (1988) Improved silver staining procedure for fast staining in PhastSystem Development Unit. I. Staining of sodium dodecyl sulfate gels. Electrophoresis 9, 28 –32[CrossRef][Medline]

  14. Wilm, M., Shevchenko, A., Houthaeve, T., Breit, S., Schweigerer, L., Fotsis, T., and Mann, M. (1996) Femtomole sequencing of proteins from polyacrylamide gels by nano-electrospray mass spectrometry. Nature 379, 466 –469[CrossRef][Medline]

  15. Baker, M., Busse, H., and Vogt, M. (2000) in Medical Imaging 2000: Image Processing (Hanson, K. M., ed) Vol. 3979, pp.426 –436, SPIE Press, Bellingham, WA

  16. Gold, S., Rangarajan, A., Lu, C.-P., Pappu, S., and Mjolsness, E. (1998) New algorithms for 2D and 3D point matching: pose estimation and correspondence. Pattern Recogn. 31, 1019 –1031[CrossRef]

  17. Vestal, M., and Juhasz, P. (1998) Resolution and mass accuracy in matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry. J. Am. Soc. Mass Spectrom. 8, 892 –911[CrossRef]

  18. Benedetti, H., Raths, S., Crausaz, F., and Riezman, H. (1994) The END3 gene encodes a protein that is required for the internalization step of endocytosis and for actin cytoskeleton organization in yeast. Mol. Biol. Cell 5, 1023 –1037[Abstract]

  19. Liang, P., and MacRae, T. H. (1997) Molecular chaperones and the cytoskeleton. J. Cell Sci. 110, 1431 –1440[Abstract]

  20. Gething, M. J., Sambrook, J., Ogawa, M., Matsuzaki, Y., Nishikawa, S., Hayashi, S., Kunisada, T., Sudo, T., Kina, T., and Nakauchi, H. (1992) Protein folding in the cell. Nature 355, 33 –45[CrossRef][Medline]

  21. Voges, D., Zwickl, P., and Baumeister, W. (1999) The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu. Rev. Biochem. 68, 1015 –1068[CrossRef][Medline]

  22. Chu-Ping, M., Slaughter, C. A., and DeMartino, G. N. (1992) Purification and characterization of a protein inhibitor of the 20S proteasome (macropain). Biochim. Biophys. Acta 1119, 303 –311[CrossRef][Medline]

  23. Dubiel, W., Pratt, G., Ferrell, K., and Rechsteiner, M. (1992) Purification of an 11 S regulator of the multicatalytic protease. J. Biol. Chem. 267, 22369 –22377[Abstract/Free Full Text]

  24. Ma, C. P., Slaughter, C. A., and DeMartino, G. N. (1992) Identification, purification, and characterization of a protein activator (PA28) of the 20 S proteasome (macropain). J. Biol. Chem. 267, 10515 –10523[Abstract/Free Full Text]

  25. Hershko, A. (1997) Roles of ubiquitin-mediated proteolysis in cell cycle control. Curr. Opin. Cell Biol. 9, 788 –799[CrossRef][Medline]

  26. Hershko, A., and Ciechanover, A. (1998) The ubiquitin system. Annu. Rev. Biochem. 67, 425 –479[CrossRef][Medline]

  27. King, R. W., Deshaies, R. J., Peters, J. M., and Kirschner, M. W. (1996) How proteolysis drives the cell cycle. Science 274, 1652 –1659[Abstract/Free Full Text]

  28. Pagano, M. (1997) Cell cycle regulation by the ubiquitin pathway. FASEB J. 11, 1067 –1075[Abstract]

  29. Gerke, V., and Moss, S. E. (2002) Annexins: from structure to function. Physiol. Rev. 82, 331 –371[Abstract/Free Full Text]

  30. Schlaepfer, D. D., and Haigler, H. T. (1990) Expression of annexins as a function of cellular growth state. J. Cell Biol. 111, 229 –238[Abstract/Free Full Text]

  31. Burgoyne, R. D., Schlaepfer, D. D., and Haigler, H. T. (1988) Calpactin in exocytosis. Nature 331, 20[CrossRef][Medline]

  32. Hong, K., Duzgunes, N., and Papahadjopoulos, D. (1981) Role of synexin in membrane fusion. Enhancement of calcium-dependent fusion of phospholipid vesicles. J. Biol. Chem. 256, 3641 –3644[Abstract/Free Full Text]

  33. de Coupade, C., Gillet, R., Bennoun, M., Briand, P., Russo-Marie, F., and Solito, E. (2000) Annexin 1 expression and phosphorylation are upregulated during liver regeneration and transformation in antithrombin III SV40 T large antigen transgenic mice. Hepatology 31, 371 –380[CrossRef][Medline]

  34. Frey, B. M., Reber, B. F., Vishwanath, B. S., Escher, G., and Frey, F. J. (1999) Annexin I modulates cell functions by controlling intracellular calcium release. FASEB J. 13, 2235 –2245[Abstract/Free Full Text]

  35. Handel, S. E., Rennison, M. E., Wilde, C. J., and Burgoyne, R. D. (1991) Annexin II (calpactin I) in the mouse mammary gland: immunolocalization by light- and electron microscopy. Cell Tissue Res. 264, 549 –554[CrossRef][Medline]

  36. Tzivion, G., and Avruch, J. (2002) 14-3-3 proteins: active cofactors in cellular regulation by serine/threonine phosphorylation. J. Biol. Chem. 277, 3061 –3064[Free Full Text]

  37. Schechtman, D., and Mochly-Rosen, D. (2001) Adaptor proteins in protein kinase C-mediated signal transduction. Oncogene 20, 6339 –6347[CrossRef][Medline]

  38. Chang, B. Y., Conroy, K. B., Machleder, E. M., and Cartwright, C. A. (1998) RACK1, a receptor for activated C kinase and a homolog of the beta subunit of G proteins, inhibits activity of src tyrosine kinases and growth of NIH 3T3 cells. Mol. Cell. Biol. 18, 3245 –3256[Abstract/Free Full Text]

  39. Yaka, R., Thornton, C., Vagts, A. J., Phamluong, K., Bonci, A., and Ron, D. (2002) NMDA receptor function is regulated by the inhibitory scaffolding protein, RACK1. Proc. Natl. Acad. Sci. U. S. A. 99, 5710 –5715[Abstract/Free Full Text]

  40. Yarwood, S. J., Steele, M. R., Scotland, G., Houslay, M. D., and Bolger, G. B. (1999) The RACK1 signaling scaffold protein selectively interacts with the cAMP-specific phosphodiesterase PDE4D5 isoform. J. Biol. Chem. 274, 14909 –14917[Abstract/Free Full Text]

  41. Liliental, J., and Chang, D. D. (1998) Rack1, a receptor for activated protein kinase C, interacts with integrin beta subunit. J. Biol. Chem. 273, 2379 –2383[Abstract/Free Full Text]

  42. Usacheva, A., Smith, R., Minshall, R., Baida, G., Seng, S., Croze, E., and Colamonici, O. (2001) The WD motif-containing protein receptor for activated protein kinase C (RACK1) is required for recruitment and activation of signal transducer and activator of transcription 1 through the type I interferon receptor. J. Biol. Chem. 276, 22948 –22953[Abstract/Free Full Text]

  43. Hermanto, U., Zong, C. S., Li, W., and Wang, L. H. (2002) RACK1, an insulin-like growth factor I (IGF-I) receptor-interacting protein, modulates IGF-I-dependent integrin signaling and promotes cell spreading and contact with extracellular matrix. Mol. Cell. Biol. 22, 2345 –2365[Abstract/Free Full Text]

  44. Groner, B., and Hennighausen, L. (2000) Linear and cooperative signaling: roles for Stat proteins in the regulation of cell survival and apoptosis in the mammary epithelium. Breast Cancer Res. 2, 149 –153[CrossRef][Medline]

  45. Kelman, Z., Wait, R., Rawlinson, L., Clark, A. R., and Saklatvala, J. (1997) PCNA: structure, functions and interactions. Oncogene 14, 629 –640[CrossRef][Medline]

  46. Kamada, S., and Miwa, T. (1992) A protein binding to CArG box motifs and to single-stranded DNA functions as a transcriptional repressor. Gene (Amst.) 119, 229 –236[CrossRef][Medline]

  47. Yabuki, T., Miyagi, S., Ueda, H., Saitoh, Y., and Tsutsumi, K. (2001) A novel growth-related nuclear protein binds and inhibits rat aldolase B gene promoter. Gene (Amst.) 264, 123 –129[CrossRef][Medline]

  48. Mikheev, A. M., Mikheev, S. A., Zhang, Y., Aebersold, R., and Zarbl, H. (2000) CArG binding factor A (CBF-A) is involved in transcriptional regulation of the rat Ha-ras promoter. Nucleic Acids Res. 28, 3762 –3770[Abstract/Free Full Text]

  49. Dean, J. L., Sully, G., Wait, R., Rawlinson, L., Clark, A. R., and Saklatvala, J. (2002) Identification of a novel AU-rich element-binding protein which is related to AUF1. Biochem. J. 366, 709 –719[CrossRef][Medline]

  50. Shen, E. C., Henry, M. F., Weiss, V. H., Valentini, S. R., Silver, P. A., and Lee, M. S. (1998) Arginine methylation facilitates the nuclear export of hnRNP proteins. Genes Dev. 12, 679 –691[Abstract/Free Full Text]

  51. Rehbein, M., Kindler, S., Horke, S., and Richter, D. (2000) Two trans-acting rat-brain proteins, MARTA1 and MARTA2, interact specifically with the dendritic targeting element in MAP2 mRNAs. Brain Res. Mol. Brain Res. 79, 192 –201[Medline]

  52. Desai, K. V., Xiao, N., Wang, W., Gangi, L., Greene, J., Powell, J. I., Dickson, R., Furth, P., Hunter, K., Kucherlapati, R., Simon, R., Liu, E. T., and Green, J. E. (2002) Initiating oncogenic event determines gene-expression patterns of human breast cancer models. Proc. Natl. Acad. Sci. U. S. A. 99, 6967 –6972[Abstract/Free Full Text]

  53. Durieux, P. O., Schutz, P., Brun, R., and Kohler, P. (1991) Alterations in Krebs cycle enzyme activities and carbohydrate catabolism in two strains of Trypanosoma brucei during in vitro differentiation of their bloodstream to procyclic stages. Mol. Biochem. Parasitol. 45, 19 –27[CrossRef][Medline]

  54. Izumi, S., Manabe, A., Tomoyasu, A., Kihara-Negishi, F., Ariga, H., van Erp, H. E., Rijksen, G., van der Saag, P. T., Staal, G. E., Durieux, P. O., Schutz, P., Brun, R., and Kohler, P. (1995) Molecular cloning of the complementary DNA for the mouse pyruvate kinase M-2 gene whose expression is dependent upon cell differentiation. Biochim. Biophys. Acta 1267, 135 –138[Medline]

  55. van Erp, H. E., Rijksen, G., van der Saag, P. T., Staal, G. E., Durieux, P. O., Schutz, P., Brun, R., and Kohler, P. (1990) Phosphofructokinase and pyruvate kinase in mouse embryonal carcinoma P19 cells in relation to growth and differentiation. Differentiation 45, 199 –205[CrossRef][Medline]

  56. Bani-Yaghoub, M., Felker, J. M., Ozog, M. A., Bechberger, J. F., and Naus, C. C. (2001) Array analysis of the genes regulated during neuronal differentiation of human embryonal cells. Biochem. Cell Biol. 79, 387 –398[CrossRef][Medline]

  57. Laurent, T. C., and Fraser, J. R. (1992) Hyaluronan. FASEB J. 6, 2397 –2404[Abstract]

  58. Zhang, L., Underhill, C. B., and Chen, L. (1995) Hyaluronan on the surface of tumor cells is correlated with metastatic behavior. Cancer Res. 55, 428 –433[Abstract/Free Full Text]

  59. Gakunga, P., Frost, G., Shuster, S., Cunha, G., Formby, B., and Stern, R. (1997) Hyaluronan is a prerequisite for ductal branching morphogenesis. Development 124, 3987 –3997[Abstract]

  60. Delpech, B., Chevallier, B., Reinhardt, N., Julien, J. P., Duval, C., Maingonnat, C., Bastit, P., Asselain, B., Gakunga, P., Frost, G., Shuster, S., Cunha, G., Formby, B., and Stern, R. (1990) Serum hyaluronan (hyaluronic acid) in breast cancer patients. Int. J. Cancer 46, 388 –390[Medline]

  61. Manley, G., and Warren, C. (1987) Serum hyaluronic acid in patients with disseminated neoplasm. J. Clin. Pathol. (Lond.) 40, 626 –630[Abstract/Free Full Text]

  62. Liu, N., Gao, F., Han, Z., Xu, X., Underhill, C. B., and Zhang, L. (2001) Hyaluronan synthase 3 overexpression promotes the growth of TSU prostate cancer cells. Cancer Res. 61, 5207 –5214[Abstract/Free Full Text]

  63. Simpson, M. A., Wilson, C. M., and McCarthy, J. B. (2002) Inhibition of prostate tumor cell hyaluronan synthesis impairs subcutaneous growth and vascularization in immunocompromised mice. Am. J. Pathol. 161, 849 –857[Abstract/Free Full Text]

  64. Itano, N., Sawai, T., Miyaishi, O., and Kimata, K. (1999) Relationship between hyaluronan production and metastatic potential of mouse mammary carcinoma cells. Cancer Res. 59, 2499 –2504[Abstract/Free Full Text]

  65. Hall, A. (1998) Rho GTPases and the actin cytoskeleton. Science 279, 509 –514[Abstract/Free Full Text]

  66. da Silva, J. S., and Dotti, C. G. (2002) Breaking the neuronal sphere: regulation of the actin cytoskeleton in neuritogenesis. Nat. Rev. Neurosci. 3, 694 –704[CrossRef][Medline]

  67. Chepko, G., and Smith, G. H. (1997) Three division-competent, structurally-distinct cell populations contribute to murine mammary epithelial renewal. Tissue Cell 29, 239 –253[CrossRef][Medline]

  68. Hofer, D., Jons, T., Kraemer, J., and Drenckhahn, D. (1998) From cytoskeleton to polarity and chemoreception in the gut epithelium. Ann. N. Y. Acad. Sci. 859, 75 –84[CrossRef][Medline]

  69. Wodarz, A. (2002) Establishing cell polarity in development. Nat. Cell Biol. 4, E39 –E44[CrossRef][Medline]

  70. DePina, A. S., and Langford, G. M. (1999) Vesicle transport: the role of actin filaments and myosin motors. Microsc. Res. Tech. 47, 93 –106[CrossRef][Medline]

  71. Karki, S., and Holzbaur, E. L. (1999) Cytoplasmic dynein and dynactin in cell division and intracellular transport. Curr. Opin. Cell Biol. 11, 45 –53[CrossRef][Medline]

  72. Ali, S. M., Geisow, M. J., and Burgoyne, R. D. (1989) A role for calpactin in calcium-dependent exocytosis in adrenal chromaffin cells. Nature 340, 313 –315[CrossRef][Medline]

  73. Donnelly, S. R., and Moss, S. E. (1997) Annexins in the secretory pathway. Cell. Mol. Life Sci. 53, 533 –538[CrossRef][Medline]

  74. Konig, J., Prenen, J., Nilius, B., and Gerke, V. (1998) The annexin II-p11 complex is involved in regulated exocytosis in bovine pulmonary artery endothelial cells. J. Biol. Chem. 273, 19679 –19684[Abstract/Free Full Text]

  75. Sun, H. Q., Yamamoto, M., Mejillano, M., and Yin, H. L. (1999) Gelsolin, a multifunctional actin regulatory protein. J. Biol. Chem. 274, 33179 –33182[Free Full Text]

  76. Witke, W., Sharpe, A. H., Hartwig, J. H., Azuma, T., Stossel, T. P., and Kwiatkowski, D. J. (1995) Hemostatic, inflammatory, and fibroblast responses are blunted in mice lacking gelsolin. Cell 81, 41 –51[CrossRef][Medline]

  77. Crowley, M. R., Head, K. L., Kwiatkowski, D. J., Asch, H. L., and Asch, B. B. (2000) The mouse mammary gland requires the actin-binding protein gelsolin for proper ductal morphogenesis. Dev. Biol. 225, 407 –423[CrossRef][Medline]

  78. Chen, P., Murphy-Ullrich, J. E., and Wells, A. (1996) A role for gelsolin in actuating epidermal growth factor receptor-mediated cell motility. J. Cell Biol. 134, 689 –698[Abstract/Free Full Text]

  79. Guay, J., Lambert, H., Gingras-Breton, G., Lavoie, J. N., Huot, J., and Landry, J. (1997) Regulation of actin filament dynamics by p38 map kinase-mediated phosphorylation of heat shock protein 27. J. Cell Sci. 110, 357 –368[Abstract]

  80. Mehlen, P., Mehlen, A., Godet, J., and Arrigo, A. P. (1997) hsp27 as a switch between differentiation and apoptosis in murine embryonic stem cells. J. Biol. Chem. 272, 31657 –31665[Abstract/Free Full Text]

  81. DeOme, K. B., Fauklin, L. J., Bern, H. A., and Blair, P. B. (1959) Development of mammary tumors from hyperplastic alveolar nodules transplanted into gland-free mammary fat pads of female C3H mice. Cancer Res. 19, 515 –520

  82. Kordon, E. C., and Smith, G. H. (1998) An entire functional mammary gland may comprise the progeny from a single cell. Development 125, 1921 –1930[Abstract]

  83. Franzen, B., Linder, S., Alaiya, A. A., Eriksson, E., Fujioka, K., Bergman, A. C., Jornvall, H., and Auer, G. (1997) Analysis of polypeptide expression in benign and malignant human breast lesions. Electrophoresis 18, 582 –587[CrossRef][Medline]

  84. Alaiya, A. A., Franzen, B., Auer, G., and Linder, S. (2000) Cancer proteomics: from identification of novel markers to creation of artifical learning models for tumor classification. Electrophoresis 21, 1210 –1217[CrossRef][Medline]

  85. Eisenstein, R. S., and Rosen, J. M. (1988) Both cell substratum regulation and hormonal regulation of milk protein gene expression are exerted primarily at the posttranscriptional level. Mol. Cell. Biol. 8, 3183 –3190[Abstract/Free Full Text]

  86. Poyet, P., Henning, S. J., and Rosen, J. M. (1989) Hormone-dependent beta-casein mRNA stabilization requires ongoing protein synthesis. Mol. Endocrinol. 3, 1961 –1968[Abstract/Free Full Text]

  87. Altiok, S., and Groner, B. (1994) Beta-Casein mRNA sequesters a single-stranded nucleic acid-binding protein which negatively regulates the beta-casein gene promoter. Mol. Cell. Biol. 14, 6004 –6012[Abstract/Free Full Text]

  88. Bashirullah, A., Cooperstock, R. L., and Lipshitz, H. D. (1998) RNA localization in development. Annu. Rev. Biochem. 67, 335 –394[CrossRef][Medline]

  89. Lipshitz, H. D., and Smibert, C. A. (2000) Mechanisms of RNA localization and translational regulation. Curr. Opin. Genet. Dev. 10, 476 –488[CrossRef][Medline]

  90. Cheng, H., and Bjerknes, M. (1989) Asymmetric distribution of actin mRNA and cytoskeletal pattern generation in polarized epithelial cells. J. Mol. Biol. 210, 541 –549[CrossRef][Medline]

  91. Sundell, C. L., and Singer, R. H. (1991) Requirement of microfilaments in sorting of actin messenger RNA. Science 253, 1275 –1277[Abstract/Free Full Text]

  92. Lawrence, J. B., and Singer, R. H. (1986) Intracellular localization of messenger RNAs for cytoskeletal proteins. Cell 45, 407 –415[CrossRef][Medline]

  93. Gu, W., Pan, F., Zhang, H., Bassell, G. J., and Singer, R. H. (2002) A predominantly nuclear protein affecting cytoplasmic localization of beta-actin mRNA in fibroblasts and neurons. J. Cell Biol. 156, 41 –51[Abstract/Free Full Text]

  94. Garner, C. C., Tucker, R. P., and Matus, A. (1988) Selective localization of messenger RNA for cytoskeletal protein MAP2 in dendrites. Nature 336, 674 –677[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
S. B. Greene, P. H. Gunaratne, S. M. Hammond, and J. M. Rosen
A putative role for microRNA-205 in mammary epithelial cell progenitors
J. Cell Sci., February 15, 2010; 123(4): 606 - 618.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Jankiewicz, B. Groner, and S. Desrivieres
Mammalian Target of Rapamycin Regulates the Growth of Mammary Epithelial Cells through the Inhibitor of Deoxyribonucleic Acid Binding Id1 and Their Functional Differentiation through Id2
Mol. Endocrinol., October 1, 2006; 20(10): 2369 - 2381.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. L. Kelleher and B. Lonnerdal
Zip3 plays a major role in zinc uptake into mammary epithelial cells and is regulated by prolactin
Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1042 - C1047.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
O. Loseva and Y. Engstrom
Analysis of Signal-dependent Changes in the Proteome of Drosophila Blood Cells During an Immune Response
Mol. Cell. Proteomics, August 1, 2004; 3(8): 796 - 808.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
M300032-MCP200v1
2/10/1039    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Glossary
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Desrivières, S.
Right arrow Articles by Groner, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Desrivières, S.
Right arrow Articles by Groner, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Journal of Lipid Research   ASBMB Today 
Advertisement
spacer
Advertisement
Advertisement