|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular & Cellular Proteomics 2:325-345, 2003.
© 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
,
,¶


Laboratoire de Chimie des Protéines, ERM-0201 INSERM/CEA
¶ Laboratoire de Physiologie Cellulaire Végétale, UMR 5019 (CEA/CNRS/Université Joseph Fourier), Département Réponse et Dynamique Cellulaires, CEA-Grenoble, 17 rue des Martyrs, F-38054 Grenoble-cedex 9, France
| ABSTRACT |
|---|
|
|
|---|
-acetylated, which indicates the accurate location of the N terminus of the corresponding mature protein. With regard to function, more than 50% of the identified proteins have functions known or very likely to be associated with the chloroplast envelope. These proteins are a) involved in ion and metabolite transport, b) components of the protein import machinery, and c) involved in chloroplast lipid metabolism. Some soluble proteins, like proteases, proteins involved in carbon metabolism, or proteins involved in responses to oxidative stress, were associated with envelope membranes. Almost one-third of the proteins we identified have no known function. The present work helps understanding chloroplast envelope metabolism at the molecular level and provides a new overview of the biochemical machinery of the chloroplast envelope membranes.
Located at the interface between the stroma and the cytosol, the envelope is also the site of various transports and exchanges of ions and metabolites required for the integration of the plastid metabolism within the plant cell. Few envelope transporters have been identified and characterized at the molecular level: the triose-phosphate/phosphate translocator, an ADP/ATP translocator, several substrate-specific outer membrane channels, and two dicarboxylate translocators (for a review, see Ref. 5). Recently, a putative hexose transporter was also identified (6). More recently we described a proteomic approach that allowed the identification of several putative transporters of the chloroplast envelope (7).
A unique biochemical machinery is also present in envelope membranes. The chloroplast envelope is the site of specific biosynthetic functions i.e. synthesis of plastid membrane components (glycerolipids, pigments, prenylquinones), chlorophyll breakdown, synthesis of lipid-derived signaling molecules (fatty acid hydroperoxydes, growth regulators, or chlorophyll precursors), and participates in the coordination of the expression of nuclear and plastid genes (for a review, see Ref. 8). So far, and as for other plastid envelope components, few proteins catalyzing these biosynthetic functions have been identified and characterized at the molecular level.
Subcellular proteomic studies are essential to get access to protein location in relation with their function (for a review, see Ref. 9). Plant proteomics exemplifies perfectly this functional dimension with the recent explosion of proteomic initiatives, which are more and more focused on the analyses of subcellular compartments (for review, see Ref. 10). Plant mitochondria (11, 12), chloroplast (13), plasma membrane (14), peroxisome (15), endoplasmic reticulum (16), and the cell wall (17) have recently been studied with proteomic approaches. Subproteome sample complexity can also be reduced for a more accurate protein location. For instance, the chloroplast can be subdivided into the envelope membranes, the stroma, and the thylakoids. Recent papers describe both a systematic proteomic and an in silico approaches aiming at the identification of the thylakoid luminal and peripheral proteins (18, 19). We recently reported a subcellular proteomic analysis aiming at identifying the hydrophobic core of the chloroplast envelope (7). Using spinach chloroplast envelope fractions, this approach allowed the identification of various previously uncharacterized proteins, most of them corresponding to components of the envelope transport systems.
The aim of the present work was to enhance our understanding of the biochemical machinery of plastid envelope membranes. We applied various extraction procedures (chloroform/methanol extraction and NaOH and NaCl treatments) to get a more exhaustive array of the chloroplast envelope membrane proteins, from the most to the least hydrophobic ones. For database searching purposes, the present proteomic approach was based on Arabidopsis thaliana samples, this organism being fully sequenced (20). However, in the context of plant subproteomic studies, A. thaliana is generally not the best biochemical model as far as getting highly pure fractions of an organelle is concerned. As an informative subcellular proteomic approach requires highly purified organelle subfractions to be obtained, the procedure of chloroplast envelope purification was optimized and adapted for A. thaliana samples. Using the present strategy, we identified more than 100 envelope components of various hydrophobicity such as ion and metabolite transporters, proteins involved in fatty acids, glycerolipids, vitamins, and pigments metabolism, components of the protein import machinery, proteases, as well as many proteins of unknown function and of previously unknown subcellular localization. The identification of these proteins is extensively discussed with respect to their chloroplastic location and their implications in the chloroplast envelope metabolism. New insights of the envelope chloroplast metabolism are presently suggested.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Purification of Arabidopsis Chloroplasts
Chloroplasts from A. thaliana were purified according to Kunst (21) with the following modifications: crude chloroplasts were obtained from 400 to 500 g A. thaliana leaves and purified by isopycnic centrifugation using 6 Percoll gradients. Percoll gradients were preformed by centrifugation at 38,700 x g for 55 min (Sorvall SS-34 rotor; Sorvall, Newtown, CT). Leaves were ground two times 2 s, and the filtrate was centrifuged at 2070 x g for 2 min (Sorvall GS 3 rotor). After resuspension, chloroplasts were loaded on the top of the preformed Percoll gradients, and the gradients were centrifuged at 13,300 x g for 10 min (Sorvall swinging HB-6 rotor). Intact chloroplasts were collected from the gradients, diluted three to four times, and centrifuged at 2070 x g for 2 min (Sorvall swinging HB-6 rotor). All operations were carried out at 05 °C.
Purification of Envelope Membranes from Arabidopsis Chloroplasts
Purified intact chloroplasts were lysed in hypotonic medium in the presence of protease inhibitors (10 mM 4-morpholinepropanesulfonic acid (MOPS)1-NaOH, pH 7.8, 4 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine, and 0.5 mM
-amino caproic acid). Envelope membranes were purified from the lysate by centrifugation at 70,000 x g for 1 h (Beckman SW41-Ti rotor; Beckman, Urbana, IL) on sucrose gradients (0.93 M, 0.6 M, 0.3 M sucrose). Envelope membranes were collected at the 0.93/0.6 M interface and concentrated (after dilution three to four times in 10 mM MOPS-NaOH, pH 7.8 buffer containing protease inhibitors) using a centrifugation at 110,000 x g for 1 h (Beckman SW 41 Ti rotor). Envelope membrane preparations were stored in liquid nitrogen in 10 mM MOPS-NaOH, pH 7.8 (in the presence of protease inhibitors).
Differential Extractions of Envelope Membrane Proteins
Protein contents of membrane fractions were estimated using the Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA) (22). In order to remove most of the soluble stromal proteins contaminating the chloroplast envelope vesicles, envelope membrane preparations were first treated by sonication as previously described (23). The resulting mixture was stored for 15 min on ice before centrifugation (4 °C, 20 min, 12,000 x g), and proteins recovered in the pellet (membrane proteins) were further analyzed, while solubilized proteins (most of the stromal contaminants) were discarded.
The more hydrophobic proteins of the chloroplast envelope were extracted from envelope preparations using a 5/4 (v/v) chloroform/methanol mixture as previously described (7, 24, 25). Envelope membranes (0.5-mg proteins in 0.1-ml storage buffer) were slowly diluted in 0.9 ml of cold chloroform/methanol (2:1, v/v) solution. The resulting mixture was stored for 15 min on ice before centrifugation (4 °C, 20 min, 12,000 x g). Proteins insoluble in the organic phase were recovered as a white pellet and discarded. Proteins present in the organic phase were precipitated with cold acetone (-20 °C) and resuspended in 50 µl of SDS-PAGE buffer.
Chloroplast envelope proteins were also extracted using alkaline (NaOH, 0.5 M) or salt treatments (NaCl, 1 M). In order to solubilize membrane proteins present in both the outer and the inner surfaces of the vesicles, sonication of the membrane preparations was also performed during these two treatments. The resulting mixtures were stored for 15 min on ice before centrifugation (4 °C, 20 min, 12,000 x g). Insoluble proteins were recovered as white pellets and resuspended in 50 µl of SDS-PAGE buffer.
SDS-PAGE and Western Blot Analyses
Proteins were loaded on 12% acrylamide gels for SDS-PAGE analyses (26). For the analyses of subplastidial fractions and for Western blot analyses, each fraction contained 15 µg of proteins. For tandem mass spectrometry (MS/MS) experiments, 3050 µg of proteins (estimations from SDS-PAGE analyses) were loaded on 12% acrylamide gels (7-cm gels, Bio-Rad). The ceQORH protein was detected using the purified antibodies diluted 1:5000 and using alkaline phosphatase staining as previously described (23). The light harvesting complex proteins (LHCPs) were detected using rabbit polyclonal antibodies (a gift from Dr. Olivier Vallon; Institut de Biologie Physico-Chimique, Paris, France) diluted 1:10,000 and using alkaline phosphatase staining.
Mass Spectrometry and Protein Identification
After SDS-PAGE (migration was stopped just between the stacking and the separating gels so that proteins were concentrated on a very fine band for further analyses), a discrete band was excised from the Coomassie blue-stained gel. The in-gel digestion was carried out as previously described (25). Gel pieces were then extracted with 5% (v/v) formic acid solution and acetonitrile. After drying, tryptic peptides were resuspended in 0.5% aqueous trifluoroacetic acid. The samples were injected into a LC-Packings (Dionex, Sunnyvale, CA) nanoLC system and first preconcentrated on a 300 µm x 5 mm PepMap C18 precolumn. The peptides were then eluted onto a C18 column (75 µm x 150 mm). The chromatographic separation used a gradient from solution A (5% water, 95% acetonitrile, 0.1% formic acid) to solution B (5% acetonitrile, 95% water, 0.1% formic acid) over 60 min at a flow rate of 200 nl/min. The liquid chromatography (LC) system was directly coupled to quadrupole time-of-flight (QTOF) 1 or QTOF Ultima mass spectrometer (Waters, Milford, MA). MS and MS/MS data were acquired and processed automatically using MassLynx 3.5 software. Database searching was carried out using the MASCOT 1.7 program. Two protein databases were used; an updated compilation of SwissProt and Trembl (us.expasy.org/databases/sp_tr_nrdb/) and the ArabidopsisGenome Initiative protein database (ftp.arabidopsis.org/home/tair/Sequences/blast_datasets/). Proteins that were identified with at least 2 peptides showing both a score higher than 40 were validated without any manual validation. For proteins identified by only 1 peptide having a score higher than 40, the peptide sequence was checked manually. Peptides with scores higher than 20 and lower than 40 were systematically checked and/or interpreted manually to confirm or cancel the MASCOT suggestion. The remaining unassigned peptides were interpreted manually, and internet MS-Pattern (prospector.ucsf.edu/) and Blast (www.ncbi.nlm.nih.gov/BLAST/) were used for database searching.
Prediction Methods
Predictions for chloroplast localization and membrane-spanning regions were achieved using the software programs ChloroP (27) and HMMTOP (28), respectively. Predictions of functions were carried out using BLAST (www.ch.embnet.org/software/BottomBLAST.html) and InterProScan (www.ebi.ac.uk/interpro/scan.html) tools.
Transient Expression in Arabidopsis and Tobacco Cell
The green fluorescent protein (GFP) reporter plasmid 35
-sGFP(S65T) and the 35
-sGFP(S65T)-derived plasmid containing the transit peptide (TP) sequence from RBCS fused to GFP [35
-TP-sGFP(S65T)] were described previously (29).
Construction of the plasmids for expression of P56-2 or P56-4 Arabidopsis proteins fused to GFP was performed as follows. The coding region of the Arabidopsis P56-2 protein was PCR-amplified using flanking primers XhoI-N-ter (ATCCTCGAGATGAACGCGAGAGCTCTTCTTTGC) and BspHI-C-ter (GAATGGTCATGACGATTATCTTCTCTCCGGTTG). The coding region of the Arabidopsis P56-4 protein was PCR-amplified using flanking primers XhoI-N-ter (AGACTCGAGATGGCCCTCGGTGGCTTGATTTC) and AflIII-C-ter (GGTACATGTCGAGAATTTTTTCTCCGGTTGCG). Both PCR products were cloned into the pBluescript SK- Vector. The XhoI-BspHI (P56-2) or XhoI-AflIII (P56-4) fragments cleaved from these plasmids were inserted into the SalI-NcoI-digested GFP reporter plasmid 35
-sGFP(S65T) to create the 35
-P56-2-sGFP(S65T) and 35
-P56-4-sGFP(S65T) vectors, respectively. Correct orientation and sequence of the inserted fragments were controlled. The plasmids used for tissue bombardment were prepared using the QIAfilter Plasmid Midi Kit (Qiagen Laboratories, Hiden, Germany).
For transient expression of the proteins, plasmids of appropriate constructions (1 µg) were introduced into Arabidopsis and BY2 cells using a pneumatic particle gun (PDS-1000/He; Bio-Rad). Growth of Arabidopsis or BY2 cells, conditions of cell bombardment, and fluorescence microscopy were as previously described (23).
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
|
|
|
|
|
|
In contrast, traces of some of the major thylakoid proteins in envelope subfractions appear to be concentrated during the extraction of hydrophobic proteins using chloroform/methanol (see supplemental data). Indeed, extraction in organic solvent allows the recovery of more than 30% of the thylakoid membrane proteins but only 5% of the envelope proteins (as estimated from the ratio of soluble and insoluble proteins using SDS-PAGE analyses of dilutions obtained from both fractions; see Ref. 25). Consequently, extractions of envelope fractions using organic solvents resulted in the enrichment of major thylakoid integral membrane proteins (19% thylakoid proteins), even if original thylakoid contamination was shown to be very low (about 2% in average).
The aim of a targeted proteomic study, such as the present one, is to provide relevant identifications for subsequent functional study. Our aim being the identification of envelope proteins, the identified proteins were classified according to their known (IM, OM, S, T, S/EB, S/TB, To) or putative (IM?, OM?, E?, PM?, G?, To?) localization (see Table I). Known localizations were essentially retrieved from previous studies. Although being arbitrary, putative localizations were assessed using rigorous criteria. Putative localization in the inner membrane (referred to IM? in Table I) was suggested with respect to the strong hydrophobicity and the presence of a predicted chloroplastic transit peptide (7). Moreover, as discussed further, some of these proteins have putative functions that are compatible with their localization in the chloroplast inner envelope membrane.
Putative localization in the outer membrane refers to high homology with previously characterized outer envelope proteins (orthologous proteins) from other plant species (referred to OM? in Table I). Putative localization in the envelope (referred to E? in Table I) was suggested because of the very low contamination level, keeping in mind that all identified contaminants are major and characterized proteins in their respective subcellular compartments. Some of these proteins (HP90, HP22, HP30-2, HP30, and HP35), likely to be located in the envelope, show different levels of homology with proteins, previously classified as members of mitochondrial transporter families. As no known protein from mitochondria was detected in the present proteomic approach, these putative (but uncharacterized) transporters are rather unlikely to be actually located in mitochondria. Other putative locations (referred to To?, PM?, and G? in Table I) were deduced from the strong homology with proteins of known location. According to the classification described above, about 80% (89/112) of the identified proteins can be considered as genuine envelope proteins (Fig. 5), only 9/89 being peripheral envelope proteins (referred to S/EB in Table I) and the 80/89 remaining ones being either genuine outer or inner envelope membrane proteins. However, one cannot exclude that some of the stromal proteins could actually be bound to the envelope, as suggested, for example, for the multienzyme complexes with Benson-Calvin cycle activities (31) or for the acetyl-CoA carboxylase (32). Finally, 15% are proteins from other chloroplast subcompartments (stroma and thylakoids), and only 6% of the identified proteins are not chloroplastic proteins.
|
|
|
Other peptides located at the N terminus of some Arabidopsis proteins were found N-acetylated. With respect to this observation, previously identified spinach envelope protein-derived tryptic peptides (7) were checked for the presence of such posttranslational modifications. N
-acetylation is acknowledged to be a common post-translational modification of eukaryotic protein N termini. Indeed it was estimated that 70% of eukaryotic soluble proteins were N-acetylated (34, 35). Some proteins, HP22, OMP24, and OEP6, were not predicted for having a chloroplastic transit peptide. Moreover, two of them, OMP24 and OEP6, are known to be located in the outer envelope membrane, which excludes the requirement for a transit chloroplastic peptide. In agreement with these predictions, N
-acetylation occurred at the very N-terminal end of the protein and concerned the N-terminal methionine (OEP6) or the second amino acid residue (OMP24, HP22).
Other proteins were predicted for having a chloroplastic transit peptide. For proteins HP30c, HP27b, IEP18 (At), IEP18 (So), IEP62, FD6C, and IEP33 (So), N-acetylated peptides were found very close to the predicted maturation site. For proteins HP45 and IEP33 (At), N-acetylated peptides were found about 60 amino acids downstream of the predicted maturation site, thus suggesting that the prediction is not correct for these two proteins. Two other cases were not in agreement with ChloroP predictions: HP36 and HP60. Indeed, no maturation site was predicted for these proteins, while an N-acetylated peptide was found close to the N terminus of these proteins. Nevertheless, the relative connection between predictions and proteomic results shows that the maturation site prediction of plastid envelope proteins using the ChloroP program is rather accurate.
Many post-translational modifications have been described for plant and more precisely for chloroplast proteins. Indeed, methylation and carbamylation of proteins of the RuBisCo complex (36, 37), glycosylation of a chloroplastic coupling factor (38), palmitoylation of chloroplastic herbicide-binding protein (39), and phosphorylation of a thylakoid protein (40) have been described. N-acetylation of thylakoid proteins has emerged as an intriguing feature of the photosystem II. In addition to being found in four LHC II molecules, it is also found in three out of four phosphoproteins of the photosystem II core (4143). The three identified N-acetylated peptides correspond to the N termini of Dl, D2, and CPa-2 (PsbA, PsbC, and PsbD) proteins and each begins with N-acetyl-0-phosphothreonine. In a paper dealing with thylakoid proteins, Peltier et al. (18) quoted that among 55 proteins analyzed by Edman degradation none were likely to be blocked at the N terminus. The authors concluded that the N termini of most mature chloroplastic proteins are unlikely to be further modified (18). Indeed, all nuclear-encoded chloroplastic proteins, which bear a transit peptide, are processed at the N terminus after import to remove this peptide. Thus, possible N
-terminal modifications of the protein precursors that occurred in the cytosol are likely to be removed for proteins targeted to the chloroplast via a cleavable transit peptide. Conversely, N
-acetylation of processed proteins that are known to be targeted to the inner envelope membrane, e.g. IEP18 (24), HP45 and IEP60 (7), and FD6C (44), would imply an N
-acetylation process in the course or after transit peptide cleavage. The question arising from these N-acetylations is the following: do they result from an in vivo process or are they an experimental artifact? For instance, it is acknowledged that carbamylation can occur in the presence of urea (45) and thus can be artifact. In the present study, N-acetylation was only observed for peptides likely to correspond to the N terminus of the chloroplast envelope proteins. Therefore, if chemical N
-acetylation occurred, it would have been before tryptic cleavage. The procedure used from chloroplast fractionation to SDS-PAGE analysis and before trypsin digestion is not in favor of a chemical N
-acetylation. Consequently, in vivo N
-acetylation of chloroplast envelope proteins is very likely to occur in the course or after transit peptide cleavage. As described in the literature (34), N
-acetyltransferases have specific substrates, either glycine, alanine, serine, or threonine residues (GAST substrates) or methionine residue (M substrate). In good agreement, among the 14 N
-acetylations described in Fig. 7, 12 correspond to GAST substrates and 1 to an M substrate. Furthermore, in the case of the M substrate, N
-acetylation occurred because the adjacent amino acid residue is a glutamic acid, in agreement with the literature (34). Therefore, and as previously observed for thylakoid proteins (4143), we can conclude that N
-acetylation actually occurs for chloroplast envelope proteins. Consequently, when such N
-acetylated tryptic peptides are identified, this suggests that these peptides might be the potential N termini of the corresponding mature proteins.
The question of the exact location of the N terminus of these chloroplast envelope proteins could be addressed by intact protein mass measurements. This strategy has been advocated for chloroplast thylakoid proteomics (43) and developed into a viable proteomics strategy with LC-MS analyses (46). The technology to perform intact protein mass measurements on integral membrane proteins, including transporters with up to 15 transmembrane helices, using electrospray ionization has been developed (4750) and would be of great help to answer this question.
A Combination of Strategies and Plant Models Is Required to Perform the Exhaustive Identification of the Chloroplast Envelope Proteins
The present proteomic study, performed on subfractions deriving from Arabidopsis chloroplast envelope membranes, allowed identifying more than 100 plastid proteins, most of them being genuine envelope components. Because the Arabidopsis genome has been fully sequenced, this plant is the model of choice for proteomic analyses as far as protein identification is concerned. It appears, however, that a combination of strategies (proteomic and in silico approaches) and plant models is required to perform the exhaustive identification of the chloroplast envelope proteins. When focusing on the same chloroform/methanol extraction of envelope purified from both Arabidopsis (this work) and spinach (7) chloroplasts, it appears that 15 proteins were exclusively found in Arabidopsis while more than 20 were exclusively found in the spinach samples (see supporting data, "Extraction Methods"). This suggests that several plant models may be required to identify chloroplast envelope proteins.
All known inner envelope proteins contain a classical N-terminal plastid transit peptide and thus should be predicted as localized in plastids using in silico approaches. However, while localized in the inner membrane of the chloroplast envelope, the ceQORH identified in the plastid envelope could not be predicted to be localized in plastids (Table II), because it lacks a classical N-terminal and cleavable plastid transit peptide (23). Likewise, the HP36 protein could not be predicted to be plastid localized (Table II) because of an error in the prediction of the 5' region in the Arabidopsis open reading frame during the Arabidopsis genome annotation (7). Toc159 (51, 52) or OEP21 (53), some major outer envelope proteins, could not be predicted to be localized in plastids (Table II) because they lack a classical N-terminal chloroplast transit peptide, like most outer envelope membrane proteins. Toc159 and Tic55 were initially identified in pea chloroplast envelope membranes (54) as components of the chloroplast protein import machinery. These two proteins were identified in Arabidopsis but not detected in spinach (Table II).
|
|
The Protein Import Machinery of Chloroplast Envelope Membranes
Import of nuclear-encoded precursor proteins into the chloroplast occurs through translocon complexes at the outer (Toc complex) and inner (Tic complex) envelope membranes. Numerous biochemical studies resulted in the characterization of components of the chloroplast import machinery (for reviews, see Refs. 3 and 4). We identified a series of proteins previously known to be part of the Toc or the Tic complexes. Some of them have a high homology with pea (Pisum sativum) proteins (from which most of the import proteins were identified). Table I demonstrates the identification of the three main components of the Toc complex: Toc34, Toc75 (OEP75), Toc159 (OEP86). We also identified Toc33, a protein similar to Toc34, and a Toc64-like (HP64b) protein. Toc34 and Toc159 are GTP-binding proteins involved in precursor recognition, and Toc75 is forming an aqueous protein-conducting channel (for review, see Ref. 3). Toc64 is expected to function as a docking protein for cytosolic cofactors of the protein import into chloroplasts (62). Concerning components of the Tic complex, we identified a series of proteins such as Tic40, Tic55, a Tic55-like (HP62) protein, and proteins with homology with Tic20 (IEP16) and Tic62 (HP26c). Tic22 was the only lacking component of the previously identified members of the Tic complex. This is not surprising because Tic22 is highly hydrophilic, contains no apparent membrane spanning domains, and is localized in the intermembrane space of the envelope (for review, see Refs. 14). Therefore, Tic22 is likely to be excluded from the samples we analyzed because it was extracted from the envelope by all the different treatments performed in this study. In contrast, Tic20 is a hydrophobic, integral membrane protein playing a role in preprotein conductance at the inner envelope membrane (63, 64). Tic40 was proposed to have a putative Hsp70 chaperone-interacting function (65). Tic55 contains a predicted Rieske-type iron-sulfur cluster and was shown to be part of the core of the Tic complex (54). The N terminus of Tic62 shows strong homologies to NAD(H) dehydrogenases in eukaryotes and to Ycf39-like proteins present in cyanobacteria and nongreen algae (66). We also identified several chaperones involved in protein import, HP112 (IAP100) and ClpC. IAP100 was proposed to serve in recruiting chaperonin for folding of newly imported proteins (67). ClpC, a soluble Hsp100 chaperone that appears to interact directly with Tic110, is thought to provide the driving force for chloroplast protein import (54, 68). Although identified as a stroma protein, ClpC is clearly functionally associated with the envelope membrane.
In addition, we found three proteins (HP22, HP30, HP30-2) with some homology to components of the mitochondrial import machinery (Tim17/Tim22). This confirms our previous findings on spinach, where we identified another homolog of the Tim complex, namely HP20 (7). Because we can rule out a specific contamination of chloroplast envelope membranes by Tim components (see above), our analyses demonstrate the unexpected presence in chloroplast envelope membranes of a series of proteins having homologies with components of the mitochondrial protein import machinery. In mitochondria, Tim17 (together with Tim23) constitute the import channel for preproteins containing amino-terminal hydrophilic presequences (69). The Tim17, Tim22, and Tim23 proteins have in common a similar topology in the membrane and a homologous amino acid sequence. Interestingly, they show a sequence similarity to OEP16, a channel-forming amino acid transporter in the outer envelope of chloroplasts, and to LivH, a component of a prokaryotic amino acid permease (69). One can question whether these proteins are true components of the Tic/Toc complexes or whether another import system is present in chloroplast envelope membranes. A similar question raised by the identification of an inner envelope protein containing internal targeting information (23) is whether it is imported by distinct import mechanism, like in mitochondria (70, 71), or by the normal Tic/Toc complexes used by precursor proteins containing cleavable N-terminal transit sequences.
Finally, our results provide further evidence for the use of cyanobacterial ancestor genes to build up the chloroplast envelope import machinery. Several examples have been already described. For instance, Toc75 is rather close, in sequence as well as in topography, to a cyanobacterial channel-forming protein (51, 72). We identified HP65b, a protein having homology with the Synechocystis protein Q55511. This cyanobacterial protein is likely to be involved in protein export and could act as a chaperonin by maintaining the newly synthesized protein in an open conformation. A similar function of the related chloroplast protein is therefore rather possible.
Envelope Membranes and Enzymes of the Lipid Metabolism
Through our proteomics studies on spinach (7) and Arabidopsis chloroplast envelope membranes (this work, Table I), we have identified several proteins involved in lipid metabolism (for a survey of the genes encoding these enzymes, see Ref. 73). The first step of chloroplast membrane lipid biosynthesis is the acylation of glycerol 3-phosphate to form phosphatidic acid. This is catalyzed by two acyltransferases: the first one, responsible for lysophosphatidic acid biosynthesis, is a stromal enzyme active in the vicinity of the inner envelope membrane (74), whereas the second one, responsible for phosphatidic acid biosynthesis, resides to the inner membrane (for review, see Ref. 75). Indeed, we identified 2-lysophosphatidate acyltransferase (76), an enzyme catalyzing the transfer of 16:0 (from 16:0-ACP) to the sn-2 position of lysophosphatidic acid, leading to the synthesis of phosphatidic acid, the precursor for chloroplast glycerolipids. MGD1, one of the three Arabidopsis monogalactosyldiacylglycerol (MGDG) synthases, the last committed step in MGDG biosynthesis, was identified in our previous study on spinach (7). This protein is a very minor envelope protein (77), thus providing some reason for its absence in the list of Arabidopsis proteins. Concerning the formation of other chloroplast-specific glycerolipids, we identified proteins that could participate to phosphatidylglycerol (PG) synthesis. The protein HP32c is a phosphatidylglycerophosphate synthase (or CDP-diacylglycerol:glycerol-3-phosphate phosphatidyltransferase); an Arabidopsis mutant, impaired in the corresponding gene (pgp1), has an overall PG content reduced by 30% and shows an 80% reduction in plastidial enzyme activity (78). Envelope membranes also contain a protein (HP25b) that is a phosphatidylglycerophosphate synthase-like protein (for review, see Ref. 79). Interestingly, in silico analyses (7) suggested that a putative CDP-diacylglycerol synthetase (At4g26770) could be present in envelope membranes. This enzyme could be the first step committed to chloroplast PG synthesis.
Chloroplast glycerolipids synthesized through the envelope membranes contain saturated (16:0) and monounsaturated fatty acids (18:1) and are therefore substrates for fatty acid desaturases that catalyze the formation of the polyunsaturated molecular species characteristic of plastid glycerolipids. Although genetic approaches shed new light on chloroplast membrane desaturases with the characterization of Arabidopsis mutants (for review, see Ref. 80), there was only little evidence for such enzymes to be present in chloroplast envelopes (81). Indeed, we identified in envelope membranes two desaturases, namely FD3C and FD6C, corresponding respectively to omega-3 and omega-6 fatty acid desaturases. Genetic analyses on fad6 (FD6C) and fad7 (FD3C) mutants demonstrated that they are both chloroplast enzymes active on glycerolipids, and especially on galactolipids (for review, see Ref. 80). FD6C (oleate desaturase) catalyzes the formation of C18:2 from monounsaturated fatty acids, whereas FD3C (plastidial linoleate desaturase) introduces the third double bond leading to the formation of linolenate. Fatty acid desaturation is a complex process that requires an electron transfer chain. Using electron paramagnetic resonance spectroscopy, Jäger-Vottero et al. (82) characterized in the spinach chloroplast envelope electron paramagnetic resonance signals corresponding to putative components of an electron transfer chain. None of the envelope components responsible for such signal have been identified to date, but the identification of a putative quinone oxidoreductase (IEP41; Ref. 23) in our spinach preparation may provide a first clue toward characterization of members of an envelope electron transfer chain. Interestingly, we also identified a putative flavin-containing oxidoreductase (HP52b).
In plant cells, most saturated and monounsaturated fatty acids are synthesized within the plastid stroma, but they are also used in the endoplasmic reticulum for the biosynthesis of phospholipid (phosphatidylcholine, phosphatidylethanolamine, etc.) and therefore have to be exported to the cytosol. An hypothesis is that the acyl-CoA synthetase (which is located on the outer envelope membrane, Ref. 83) could be involved in fatty acids export from chloroplasts. We identified in Arabidopsis envelope membranes two proteins (HP76 and HP81) that could correspond to acyl-CoA synthetases. They were both among the 11 putative acyl-CoA synthetases identified by Shokey et al. (84) in their survey of the Arabidopsis genome. These authors demonstrated that only nine of these genes actually encoded long-chain acyl-CoA synthetases (LACS). Although containing a putative AMP-binding site, HP81 is actually not a LACS because i) it was unable to complement yeast mutants and ii) the overexpressed protein was unable to synthesize acyl-CoAs. The exact function of this envelope protein therefore remains to be identified. In contrast, HP76 corresponds to one of the LACS proteins, namely LACS9. This protein was demonstrated by Schnurr et al. (85) to complement yeast mutants and to catalyze the synthesis of acyl-CoAs. Most interestingly, they found that this protein is the major plastid acyl-CoA synthetase, and, by in vitro protein import and GFP fusion experiments, they demonstrated that it was targeted to the chloroplast envelope. Interestingly, LACS9 could not be extracted by a NaOH washing of chloroplast envelope membranes, in good agreement with our findings. This protein does not have any transit peptide and resides at the outer envelope membrane, as shown by previous biochemical studies (83).
Oxylipins are metabolites produced by the oxidative transformation of unsaturated fatty acids via a series of diverging metabolic pathways. Blée and Joyard (86) demonstrated that chloroplast envelope membranes can synthesize oxylipins, owing to enzymes like allene oxide synthase and hydroperoxyde lyase. Indeed, Froehlich et al. (87) demonstrated that these two proteins are respectively targeted to the inner and outer envelope membrane. We identified one of these two proteins in Arabidopsis envelope membranes, namely the allene oxide synthase (CP74). We also identified a phospholipid hydroperoxide glutathione peroxidase. This enzyme, which converts fatty acid hydroperoxides into alcohols, can be part of an ascorbate-glutathione cycle (see below). Altogether, these data suggest a role for envelope membranes in plant defense-signaling pathways, because such processes involve oxylipins.
Among the proteins involved in fatty acid metabolism, we identified two proteins, HP88b and ACCD, corresponding to two subunits of the acetyl-CoA carboxylase (ACCase) complex, respectively the
and ß subunits. In general, the ACCase complex is considered as soluble and is indeed easily extracted from the chloroplast stroma. However, our results strongly support a series of observations (8890), suggesting that IEP96 (corresponding to HP88b) could be the
subunit of the ACCase. More recently, Thelen and Ohlrogge (32) demonstrated the presence of
and ß subunits of ACCase in envelope preparations by Western blot experiments. They proposed that the binding of ACCase to the chloroplast envelope could occur through nonionic interactions to the carboxyltransferase subunits. Our results provide further support to such observations: these proteins should be present at the stroma side of the inner envelope membrane, anchoring the ACCase complex to the membrane. Interestingly the ß subunit of ACCase is chloroplast encoded.
We also identified IM30, a protein that could be involved in lipid transfer between the inner envelope membrane and thylakoids. This function was postulated because of its dual localization; immunocytochemical localization of this protein revealed that the protein occurred in clusters in the vicinity of both the envelope and the thylakoid (91). Another protein, namely HP20b, was shown to contain domains homologous to domains present in lipid transfer proteins. Such proteins are essential in chloroplasts because the envelope is the site of membrane lipid biosynthesis, whereas thylakoids are the site for their accumulation.
Envelope Membranes and the Biosynthesis of Terpenoid Compounds
Chloroplast membranes contain a series of compounds deriving (at least in part) from isopentenyl pyrophosphate: carotenoids, prenylquinones, and chlorophyll precursors (for reviews, see Refs. 75 and 92). These compounds are synthesized in envelope membranes (92), but some controversy still remains (especially for prenylquinone biosynthesis). Concerning the biosynthesis of chlorophyll precursors, protochlorophyllide oxidoreductase was characterized in spinach as well as in Arabidopsis. The presence of this protein in envelope membranes was first demonstrated functionally (93), then with antibodies (94), thus suggesting that envelope membranes could play a role in the biosynthesis of chlorophyll precursors (94). Indeed, several other enzymes involved in the biosynthesis of protochlorophyllide were demonstrated to be present in purified envelope membranes (see for instance Refs. 9597). To date, none of these enzymes could be detected by proteomics.
In chloroplasts, the inner envelope membrane was shown to be the site of
-tocopherol and plastoquinone-9 synthesis (98). In contrast, Swiezewska et al. (99) proposed that plastoquinone and ubiquinone biosynthesis was in fact localized in Golgi membranes and that a specific transport system was required for plastoquinone and ubiquinone transfer, respectively, to chloroplasts and mitochondria (see also Ref. 100). Due to the difficulty in handling such membrane-associated enzymes using classical biochemical approaches, alternative approaches to clone the corresponding genes were developed. To date, only a nuclear-encoded methyltransferase (AtCOQ3) catalyzing the last step in ubiquinone biosynthesis and localized in the inner membrane from plant mitochondria was characterized (101). We identified in envelope membranes two proteins that are candidates for a role in chloroplast prenylquinone biosynthesis. IEP37, one of the major inner envelope membrane protein, is a S-adenosyl-L-methionine-dependent methyltransferase (102) having homology with UbiE/COQ5 methyltransferase, whereas HP43 presents a low homology with UBIA prenyltransferase. Interestingly, a mutant containing a transposon within the gene encoding IEP37 was shown to have a much lower content of chloroplast prenylquinones, thus suggesting that IEP37 is a methyltransferase committed to the biosynthesis of plastid prenylquinones.2 One intriguing question is why this protein is present in such large amounts in the inner envelope membrane (IEP37 is one of the major inner envelope membrane protein). Altogether, these observations are strong arguments in favor of a major role of envelope membranes in the biosynthesis of plastid prenylquinones.
Finally, major terpenoid compounds in envelope membranes are carotenoids (75). Although enzymes involved in carotenoid biosynthesis and metabolism (abscisic acid biosynthesis) have not been yet detected by proteomics in spinach or Arabidopsis chloroplast envelope membranes, in silico analyses demonstrated that ß-carotene hydroxylase, an enzyme of the zeaxanthin pathway, could be localized in envelope membranes (7).
Oxyradical Scavenging and Antioxidant Capacities o f Envelope Membranes
Plants are submitted to a wide variety of environmental stresses, like light, drought, nutrient, and temperature, that can induce oxidative stress through the formation of reactive oxygen species. This lead to major damages within membrane constituents, like lipids and proteins. For instance, large amounts of fatty acid hydroperoxides can be formed within envelope membranes. They can be metabolized through the ascorbate-glutathione cycle (for review, see Ref. 103). Indeed, we identified in Arabidospis envelope membranes several proteins that could be involved in oxidative stress responses: namely a phospholipid hydroperoxide glutathione peroxidase (PHGPx), an ascorbate peroxydase, and a superoxide dismutase. Superoxide dismutase is a soluble protein that produces hydrogen peroxide. Ascorbate peroxydase is also a soluble protein. It mediates hydrogen peroxide detoxification in a series of reactions coupled to the functioning of PHGPx. PHGPx selectively acts on hydroperoxides, converting them to alcohols and therefore preventing lipid peroxidation. It is not very clear whether PHGPx is soluble or membrane bound, but it should be active in the vicinity of the membrane. Little is known on a possible role of chloroplast PHGPx in envelope membranes. But the demonstration that mitochondrial PHGPx is involved in the protection from inactivation of the adenine nucleotide translocator during hypoglycemia-induced apoptosis (104) provides some clues toward the characterization of such a role in envelope membranes. We also identified an m-type thioredioxin (type 1), an enzyme that can induce hydrogen peroxide tolerance in chloroplasts (105). Unfortunately, we do not know the actual target of this key enzyme in chloroplast redox network.
Ascorbate also serves as an antioxidant in many other detoxification reactions, such as the scavenging of hydroxyl radicals and the reduction of tocopheryl radicals produced by
-tocopherol, by quenching autocatalytic lipid peroxidation. Because
-tocopherol is the major prenylquinone in envelope membranes (for review, see Ref. 75) and because hydroxyl radicals can be formed by various reactions in this membrane system, the association of the ascorbate-glutathione cycle to the envelope membranes (rather likely to the inner membrane) is probably a physiological requirement for protecting the membrane against harmful reactive oxygen species responsible for lipid peroxidation. Furthermore, the possible presence of a ß-carotene hydroxylase in envelope membranes (7) is also in favor of such a role. As a matter of fact, Davidson et al. (106) demonstrated that A. thaliana plants in which the chyB gene that encodes ß-carotene hydroxylase was overexpressed were more tolerant to conditions of high light and high temperature, as shown by reduced lipid peroxidation.
Finally, the damages caused to membrane proteins submitted to an oxidative stress requires the presence of active repair mechanisms. We identified several proteases in Arabidopsis envelope membranes, namely two members of the ATP-dependent Clp family and one of the GTP-dependent FtsH family. Indeed, a possible role for these proteases could be to remove the damaged protein components from the envelope membrane.
Altogether, our observations demonstrate that in addition to antioxidant molecules, like
-tocopherol, a whole set of enzymes involved in prevention of oxidative stress (responses and repair mechanisms) are present in chloroplast envelope membranes. Because the thylakoid lumen also contains enzymes active in membrane protection against oxidative stress (18), these data together with ours demonstrate that both chloroplast membrane systems (envelope membranes and thylakoids) contain complex enzymatic and nonenzymatic equipment to protect the chloroplast against oxidative stress.