Originally published In Press as doi:10.1074/mcp.M400018-MCP200 on April 26, 2004.
Molecular & Cellular Proteomics 3:770-779, 2004.
© 2004 by The American Society for Biochemistry and Molecular Biology, Inc.
Research
Microarray Transfection Analysis of Transcriptional Regulation by cAMP-dependent Protein Kinase*
Tanya M. Redmond
,
Xiaomei Ren
,
Ginger Kubish
,
Stephen Atkins
,
Sean Low
and
Michael D. Uhler
,
,¶,||
From the
Mental Health Research Institute,
Neuroscience Graduate Program, and ¶ Department of Biological Chemistry, University of Michigan, Ann Arbor, MI 48109-0669
 |
ABSTRACT
|
|---|
A wide variety of bioinformatic tools have been described to characterize potential transcriptional regulatory mechanisms based on genomic sequence analysis and microarray hybridization studies. However, these regulatory mechanisms are still experimentally verified using transient transfection methods. Current transfection methods are limited both by their large scale and by the low level of efficiency for certain cell types. Our goals were to develop a microarray-based transfection method that could be optimized for different cell types and that would be useful in reporter assays of transcriptional regulation. Here we describe a novel transfection method, termed STEP (surface transfection and expression protocol), which employs microarray-based DNA transfection of adherent cells in the functional analysis of transcriptional regulation. In STEP, recombinant proteins with biological activities designed to enhance transfection are complexed with expression vector DNAs prior to spotting on microscope slides. The recombinant proteins used in STEP complexes can be varied to increase the efficiency for different cell types. We demonstrate that STEP efficiently transfects both supercoiled plasmids and PCR-generated linear expression cassettes. A co-transfection assay using effector expression vectors encoding the cAMP-dependent protein kinase (PKA), as well as reporter vectors containing PKA-regulated promoters, showed that STEP transfection allows detection and quantitation of transcriptional regulation by this protein kinase. Because bioinformatic studies often result in the identification of many putative regulatory elements and signaling pathways, this approach should be of utility in high-throughput functional genomic studies of transcriptional regulation.
The sequences of the human, mouse, and other genomes provide the basic framework for more detailed studies of the role of gene expression in human health and disease. Although detailed transcriptional control mechanisms are known for many genes, our understanding of the transcriptional regulatory circuits involved in mammalian development and homeostasis is far from complete. Better definition of these regulatory mechanisms for the human transcriptome will require advances at several levels.
First, the estimated 2,000 transcription factors (1) encoded in the human genome require further characterization. Some of these transcription factors, such as the cAMP-response element binding (CREB)1 protein, have been well characterized in terms of structure, regulation, and recognition of cognate DNA sequences (2). However, other transcription factors are defined only by sequence homology to other invertebrate or mammalian transcription factors (3). Structural and functional studies of such uncharacterized transcription factors are greatly enhanced by the identification of cognate DNA binding sequences to enable functional assays of transcriptional activation.
At a second level, a more detailed understanding needs to be developed of the specific functional cis-acting regulatory sequences that control gene expression within the human genome. Although regulatory sequences in metazoan genes are known to occur as far as 1050 kb upstream or downstream of promoter sequences or within intronic sequences (4), most transcriptional studies currently focus on sequences within 12 kb of the transcriptional start site. The ability to identify possible regulatory sequences has been enhanced by bioinformatics analysis of genomic sequences, particularly with the use of phylogenetic footprinting (5, 6). However, very few of the putative regulatory sequences identified by phylogenetic footprinting have been experimentally verified for their ability to regulate transcriptional activity.
Finally, the activity of individual transcription factors is modulated through diverse mechanisms (4). Transcription factors may participate in heteromeric complexes, and these complexes can have distinct effects on gene transcription depending on the participating proteins. In addition, post-translational modifications, such as phosphorylation, may either activate or inactivate the transcriptional activity of an individual transcription factor. Ubiquitination, methylation, and acetylation represent further mechanisms for modulation of transcription factor activity.
In all the applications discussed above, higher throughput in transfection-based analysis could significantly increase the rate at which transcriptional regulatory mechanisms are elucidated. Currently, the transfection-based transcription reporter assay is the most widely employed in vivo method for studying the interactions of mammalian transcription factors and genomic sequences. Typically, effector constructs encoding a protein of interest are co-transfected with reporter constructs containing a specific DNA sequence required for binding of a particular transcription factor. For example, co-transfection of a protein kinase expression vector together with different promoter-reporter constructs can be used to identifiy cis-acting elements within the promoter that are responsible for transcriptional regulation by the protein kinase. These transfection-based assays are usually performed on a scale using micrograms of DNA and millions of cells, making high throughput difficult and restricting the experimental parameters of the assay.
Here we report the development of a novel transfection method, termed surface transfection and expression protocol (STEP), using only nanograms of DNA and hundreds of cells to study transcriptional regulation. During STEP, complexes are formed between DNA molecules to be transfected and recombinant proteins that are engineered to mediate the high-efficiency transfection of cells. The complexes are applied to the surface of glass slides utilizing the same standard microarrayers used for hybridization analysis. After drying of the complexes, cells are passaged onto the slide and the cells are transfected after adherence to the slide surface. We report here that this STEP method has been optimized for neuronal cell lines using GFP reporter constructs and has been employed for the quantitative analysis of PKA regulation of cAMP-responsive reporters.
 |
MATERIALS AND METHODS
|
|---|
Expression Vectors
Synthetic oligonucleotides (GGGGAATTCTTCTTGTATTCCCCTTAGTATGC and GGGAAGCTTGCTGGGCGATATAAGGATGGAC) were used to amplify the adenoviral penton protein from human adenovirus type 5 genomic DNA (Clontech, Palo Alto, CA). The resulting 1.7-kb fragment was subcloned into EcoRI- and HindIII-digested pET28a DNA to generate the pET-Penton vector. The pET-Tat-Penton vector was constructed by digesting the pET-Penton vector with EcoRI and inserting the annealed Tat oligonucleotides (AATTCGGATACGGACGGAAAAAGCGGAGACAGAGACGGAGAGGCC and AATTGGCCTCTCCGTCTCTGTCTCCGCGGGGGCCGTCCGTATCCG).
A 500-bp fragment of the human c-fos promoter was amplified using the oligonucleotides (GGGAGATCTGCAGCCCGCGAGCAGTT and GGGGAATTCCGAGGGGCGGAGACAGGTG). Both of these fragments were subcloned into EcoRI- and BglII-digested pEGFP-1 or pd2EGFP-1 (Clontech).
The plasmids pCMV.Neo, pCMV.C
, and pCMV.Cß have been described previously (7). The pEGFP-C1, pDsRed2-C1 and pCRE-d2EGFP plasmids were obtained from Clontech. Plasmid DNAs were purified by ethidium bromide-CsCl density gradient centrifugation (8).
Protein Purification
The adenoviral penton protein, HIV Tat protein, and Tat-penton fusion proteins were expressed in Rosetta cells (Novagen, Madison, WI) and purified using Ni2+-nitrilotriacetic acid affinity chromatography (Qiagen, Valencia, CA). Preparations of proteins were diluted to concentrations ranging from 0.002 to 2 mg/ml and assayed for cell transfection as described below. Subsequently, the entire preparation was diluted to the optimal concentration (typically 0.02 mg/ml) and stored at 20 °C.
PCR Amplification of a Green Fluorescent Protein (GFP) Expression Cassette
Oligonucleotides corresponding to sequences 5' of the cytomegalovirus (CMV) promoter (TTGTCCAAACTCCTAAATGTATCT) and 3' of the human growth hormone poly(A) addition sequence (TTGTAAAACGACGGCCAGTGAAT) were used to amplify a 2.4-kb fragment corresponding to the CMV promoter, Cß-coding sequence, and human growth hormone polyadenylation sequence of the pCMV.Cß plasmid (7). Oligonucleotides corresponding to sequences 5' of the cAMP response element (CRE) (TGGAGCGGCCGCAATAAAATA) and 3' of the SV40 polyadenylation sequence (TCCCCCTGAACCTGAAACATAAAA) were used to amplify a 1.5-kb fragment corresponding to the promoter, GFP-coding region, and SV40 polyadenylation region of pCRE-d2EGFP (Clontech).
STEP Transfection
For the typical STEP transfection, all plasmid DNAs were diluted to 0.12 mg/ml in water. For co-transfection assays, these stocks were mixed to give the proportions indicated (e.g. 5% CMV.PKAß). Three microliters of the mixed plasmid DNAs to be transfected were added to one well of a 96-well microtiter plate. STEP complexes were formed by the sequential addition of 3 µl of a protein complex (transferrin-poly-L-lysine conjugate (Sigma, St. Louis, MO), penton protein, Tat-penton protein, etc.) and 3 µl of a cationic lipid (2 mg/ml lipofectamine, lipofectamine 2000 (Life Technologies, Inc., Grand Island, NY), or other lipids). The resulting solution was incubated for 20 min at room temperature. Typically, the turbidity of the solution increased as the complexes formed, and microscopic particles could be observed by light microscopy at the end of the 20-min incubation. If indicated, additional factors, such as lyoprotectants (glycerol, sucrose) or cell adhesion factors (fibronectin, collagen, laminin), were added in a final 1-µl addition. All GFP reporter vectors used commercially available variant GFP proteins with point mutations to enhance GFP fluorescence.
Microarray Printing
Microarrays were printed using a Microgrid II Compact arrayer from BioRobotics (San Carlos, CA). DNA complexes were loaded into 384-well plates (Genetix, Hampshire, United Kingdom) and printed on polylysine-coated slides (Electron Microscopy Sciences, Hatfield, PA) using solid 0.7-mm pins (Apogent, Portsmouth, NH). Pins were dipped twice into the sample plate, and the complex was deposited on the slide using a 1-s dwell, under relative humidity conditions of 6575%. Spots were spaced 1.8 mm apart. Complexes were spotted three times to the same location, allowing time for complete drying between applications. The high humidity and triplicate spotting were critical for high-efficiency transfection.
Cell Plating
Exponentially growing cells (HEK-293T, SH-SY5Y, N2A, or PC-12) in Dulbeccos modified Eagles medium with 10% fetal calf serum were trypsinized and plated at the cell densities indicated (e.g. 5 x 106/ml) by placing 9 ml of the cell suspension over the microscope slide in one well of a quadriPERM plate (Vivascience, Göttingen, Germany). During the period of 1 h, most of the cells settled by sedimentation onto the slide surface. The quadriPERM plate has four wells, each of which is designed to hold a single 25-mm x 75-mm microscope slide, and the addition of 9 ml of cell suspension resulted in an initial confluency of 2080% on the slide surface for the cell densities indicated (0.52.0 x 106/ml).
Imaging and Analysis
Fluorescence microscopy of live cells was usually performed 48 h after plating with an inverted Olympus IX70 fluorescence microscope using an Illix CCD imaging system and MicroComputer Image Device software (Imaging Research, Inc., St. Catherines, Ontario, Canada) for pixel density histogram analysis. For slide scanning, cells on the slides were fixed in 100% methanol at 20 °C, and images were obtained by scanning the slides using a white-light CCD camera scanner (arrayWorx e; Applied Precision, Issaquah, WA) at 13.25-µm resolution. GFP and DsRed2 emission was visualized by using the GFP (480/520) and Cy3 filter set (Chroma, Rockingham, VT). Images were pseudo-colored using the arrayWorx e software. Fluorescence intensity was collected using the Digital Genome software (Applied Precision), exporting the total spot intensity. Error bars indicate the standard deviation of the triplicate or quadruplicate fluorescence measurements.
 |
RESULTS
|
|---|
Microarray transfection offers many potential advantages over solution transfection, including higher throughput, greater consistency across assays, and reductions in cell numbers required for cell types that are difficult to prepare. The method of reverse transfection has been reported previously in microarray transfection (9). Reverse transfection uses a commercially available lipid for transfection and gelatin to immobilize the lipid-DNA complexes to the slide surface. In our studies, we found two major disadvantages of reverse transfection. First, the method is not able to mediate high-efficiency transfection of many neuronal cell lines. Second, reverse transfection was not able to detect functional interactions in a co-transfection assay of an effector vector and a reporter vector.
In an effort to develop a method for co-transfection assays of transcriptional regulation in a microarray format in neuronal cell lines, we employed recombinant proteins known to facilitate transfection to develop STEP. Several proteins have previously been shown to increase the solution-mediated transfection efficiency, including transferrin (10), the adenoviral penton protein (11), and the HIV Tat protein (12). These proteins have not previously been applied to surface-mediated microarray transfection.
We developed STEP so that transfection complexes containing recombinant proteins could be optimized for individual cell types, using the biological functions of peptide sequences known to enhance transfection. Five different protein functionalities have been employed thus far: 1) amino acid sequences that bind to the nucleic acid to be transfected; 2) sequences that bind to cell-surface receptors and facilitate endocytosis of the DNA to be transfected; 3) sequences that facilitate the passage of proteins across membranes; 4) proteins that target DNA to the nucleus; and 5) proteins that promote the adherence or survival of cells on the STEP complex. We prepared STEP complexes of plasmid DNA with several proteins and applied the complexes to microscope slides using a robotic DNA microarrayer, as described in "Materials and Methods." After drying of the complexes onto the microscope slide, mammalian cells were passaged onto the slides, using standard tissue culture techniques, and then cultured. Under ideal conditions, cells plated onto the spotted complexes developed intracellular GFP fluorescence over the time course of 1272 h, with maximal fluorescence occurring between 24 and 48 h after cell plating (data not shown).
Many factors were optimized in the process of developing STEP transfection. First, the DNA in the STEP complex must adhere to the glass slide. Free DNA and many protein complexes do not adhere well to the slide surface. Second, the DNA complex should be evenly distributed over the spot after the complex has dried. Spotting under conditions of high humidity and the inclusion of glycerol or sucrose to the STEP complexes facilitated this even distribution. Third, the complexes must be optimized for the number of cells adhering to the spotted STEP complex. Some complexes do not promote the adherence or survival of cells and therefore exhibit low cellular fluorescence for some cell types. Fourth, the transfection efficiency, that is, the percentage of cells expressing the transfected reporter protein, varies for different complexes. Fifth, the level of expression as determined by the intensity of individual cellular fluorescence can vary for different cell types.
Fig. 1 demonstrates that STEP can mediate the high-efficiency transfection of the SH-SY5Y neuroblastoma cells. An expression vector encoding the GFP was complexed with the adenoviral penton protein as described in "Materials and Methods," and the STEP complex was spotted onto a microscope slide. SH-SY5Y cells were trypsinized and allowed to sediment onto the surface of the slide. Forty-eight hours later, live cells were imaged by fluorescence microscopy, and
60% of the cells on the STEP complex were found to express GFP. This level of efficiency compares favorable to the 610% transfection efficiency reported previously for SH-SY5Y cells (13, 14).

View larger version (92K):
[in this window]
[in a new window]
|
FIG. 1. STEP Transfection of SH-SY5Y neuroblastoma cells. A, brightfield photomicrograph of SH-SY5Y cells plated onto a microscope slide on which 200 nl of a STEP complex containing pEGFP-C1 expression vector and the adenoviral penton protein. B, grayscale fluorescence micrograph of the same field shown in A. Approximately 60% of the total cells exhibit GFP fluorescence.
|
|
Several variables had dramatic effects on transfection efficiency. The optimal conditions for any particular cell type are best determined through the use of an optimization array of different complex formulations. Fluorescence micrographs of fixed cells following a small-scale transfection optimization experiment for three different cell lines are shown in Fig. 2. This experiment demonstrates some important factors with regard to transfection optimization. First, the amount of DNA used in the STEP transfection is critical, as shown by comparison of the cellular fluorescence corresponding to spots 14 of Fig. 2B. Optimal transfection generally occurs when complexes are formed with a DNA concentration of 0.12 mg/ml, corresponding to
360 ng of total plasmid DNA on a 700-µm spot. Second, the HEK-293T cells are transfected more efficiently with complexes formed with the recombinant adenoviral penton protein, compared with complexes formed with either transferrin-polylysine or the Tat-penton fusion protein. However, the transfection efficiency of transferrin-polylysine can be increased significantly in the presence of the cell attachment factor fibronectin (Fig. 2B, spots 13 and 15). Finally, the addition of lyoprotectants such as 2.5% sucrose significantly enhances transfection of HEK-293T cells (Fig. 2B, spots 9 and 10), but addition of glycerol does not enhance transfection (Fig. 2B, spots 9 and 12).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 2. Transfection of HEK-293T, N2A neuroblastoma, and SH-SY5Y neuroblastoma cells. A, 16 different DNA complexes were prepared with pEGFP-C1 expression vector DNA as follows: (1) 0.06 µg/ml DNA, penton protein, LipofectAMINE 2000, 2.5% sucrose; (2) 0.12 µg/ml DNA, penton protein, LipofectAMINE 2000, 2.5% sucrose; (3) 0.24 µg/ml DNA, penton protein, LipofectAMINE 2000, 2.5% sucrose; (4) 0.48 µg/ml DNA, penton protein, LipofectAMINE 2000, 2.5% sucrose; (5) 0.12 µg/ml DNA, Tat-penton protein, LipofectAMINE; (6) 0.12 µg/ml DNA, Tat-penton protein, LipofectAMINE, 2.5% sucrose; (7) 0.12 µg/ml DNA, Tat-penton protein, LipofectAMINE, fibronectin; (8) 0.12 µg/ml DNA, Tat-penton protein, LipofectAMINE, 10% glycerol; (9) 0.12 µg/ml DNA, penton protein, LipofectAMINE 2000; (10) 0.12 µg/ml DNA, penton protein, LipofectAMINE 2000, 2.5% sucrose; (11) 0.12 µg/ml DNA, penton protein, LipofectAMINE 2000, fibronectin; (12) 0.12 µg/ml DNA, penton protein, LipofectAMINE 2000, 10% glycerol; (13) 0.12 µg/ml DNA, transferrin-polylysine, LipofectAMINE; (14) 0.12 µg/ml DNA, transferrin-polylysine, LipofectAMINE; 2.5% sucrose: (15) 0.12 µg/ml DNA, transferrin-polylysine, LipofectAMINE; fibronectin; (16) 0.12 µg/ml DNA, transferrin-polylysine, LipofectAMINE; 10% glycerol. B, GFP fluorescence micrograph of HEK-293T cells plated onto the 16 STEP complexes described above after fixation and scanning with a fluorescence slide scanner. C, GFP fluorescence micrograph of N2A neuroblastoma cells plated onto the 16 STEP complexes. D, GFP fluorescence micrograph of SHSY-5Y cells plated onto the 16 STEP complexes. The length of the bars in the lower right panel is 500 µm. E, Quantitation of HEK-293T cells transfected with the complexes shown in A. Cells were plated at three different densities (2 x 106 cells/ml (white bars); 1 x 106 cells/ml (gray bars); and 0.5 x 106 cells/ml (black bars)), and then incubated on the slides containing the spotted complexes for 48 h. After fixation in methanol, the slides were scanned using a fluorescence slide scanner and the GFP fluorescence quantitated as described in "Materials and Methods." F, quantitation for Neuro2A neuroblastoma cells. G, quantitation for SH-SY5Y neuroblastoma cells. H, quantitation for PC-12 pheochromocytoma cells.
|
|
The overall fluorescence of cells on an individual STEP complex varies among different cell types (Fig. 2). Although the Tat-penton protein shows significantly lower fluorescence for HEK-293T cells and N2A neuroblastoma cells (spot 6 in Fig. 2, B and C), it is one of the most efficient complexes for GFP transfection of the SH-SY5Y neuroblastoma cells (Fig. 2D, spot 6). Likewise, although transferrin-polylysine supplemented with fibronectin is a moderately efficient complex for HEK-293T cells, it is not effective for N2A neuroblastoma cells and is only moderately effective for SH-SY5Y cells.
The fluorescence micrographs like those shown in Fig. 2, BD, were analyzed in quadruplicate at three different cell densities, and the results are shown in Fig. 2, EH. The effect of cell density is variable for different cell types, with HEK-293T, N2A, and SH-SY5Y cells showing increased fluorescence with increasing cell density, while PC-12 cells show a decrease in fluorescence at the highest cell density. The absolute level of GFP fluorescence for individual cell types varies significantly, with the optimized fluorescence signal being 10-fold higher for HEK-293T and N2A cells than for SH-SY5Y or PC-12 cells. This difference in the fluorescence intensity was not due to differences in transfection efficiency because the optimized transfection resulted in 5080% GFP-positive cells for all the cell types shown (Fig. 3). These variations likely reflect different levels of GFP expression in each individual cell (Fig. 3).

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 3. Differences in cellular fluorescence following STEP transfection. A, fluorescence micrographs of HEK-293T cells following STEP transfection with complex 2 from Fig. 2 after an exposure time of 3 s. B, fluorescence micrograph of SH-SY5Y neuroblastoma cells following STEP transfection with complex 2 from Fig. 2 after an exposure time of 3 s. C, fluorescence micrograph of the same field of SH-SY5Y neuroblastoma cells shown in B but with an exposure time of 30 s.
|
|
All the experiments described above employed supercoiled plasmid vectors in order to characterize STEP transfection. Because PCR can potentially produce multiple linear expression vectors more rapidly than bacterial growth of plasmid vectors, we determined whether a PCR-generated linear expression cassette (15) could be used in STEP transfection. Fig. 4 shows a fluorescence micrograph demonstrating that a linear expression cassette for GFP was transfected efficiently into HEK-293T cells under the same conditions that are optimized for transfection of plasmid expression vectors.

View larger version (114K):
[in this window]
[in a new window]
|
FIG. 4. STEP transfection and expression of proteins encoded on linear PCR fragments. A linear fragment containing the CMV promoter, EGFP coding region, and SV40 poly(A) addition sequence was amplified and complexed prior to spotting. A, a grayscale composite brightfield and fluorescence image showing HEK-293T cells. The DNA spot is located on the right side of the image, and fluorescent cells co-localize with the DNA spot. B, fluorescence micrograph showing that 50% of the cells demonstrate EGFP expression.
|
|
After identification of the optimal transfection conditions for the various cell types, we sought to determine whether the amount of cellular fluorescence resulting from transfection of GFP expression vector could be determined in a manner that would allow the development of a quantitative transcriptional reporter assay. Transfection complexes were formed containing varying proportions of a GFP expression vector with a fixed total DNA concentration. The STEP transfection of these complexes resulted in cellular fluorescence that was linear with the proportion of GFP expression vector used (Fig. 5A). Furthermore, levels of GFP fluorescence similar to the plasmid DNA were observed for a linear expression cassette consisting of the CMV promoter, GFP-coding region, and SV40 polyadenylation sequence (Fig. 5B).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5. Characterization of GFP reporter fluorescence. A, HEK-293T cells were transfected with complexes containing the indicated percentage of CMV-EGFP plasmid DNA, with the total amount of effector plasmid balanced with CMV.Neo. After fixation, GFP fluorescence was determined. B, GFP fluorescence of HEK-293T cells transfected with supercoiled plasmid encoding GFP or a linear expression cassette for GFP generated by PCR amplification.
|
|
After optimization of the transfection process, we sought to determine whether STEP transfection could be used in a co-transfection-based reporter assay using an effector expression vector for a protein kinase and a reporter expression vector containing a regulatory DNA sequence directing expression of GFP. However, we first tested whether co-transfection efficiency was detected following STEP transfection. As shown in Fig. 6, it was noted during experiments using GFP and DsRed expression vectors that co-transfection efficiencies determined by GFP and DsRed fluorescence were greater than 95%.

View larger version (118K):
[in this window]
[in a new window]
|
FIG. 6. Co-transfection of two plasmids using STEP. DNA complexes were formed using an expression vector encoding GFP (left spot) or an expression vector encoding DsRed (middle spot) or a mixture of the two (right spot). Forty-eight hours after plating, the cells were examined by fluorescence microscopy. A, fluorescence of GFP in transfected cells. B, fluorescence of DsRed for the same field as shown in A.
|
|
In order to define the transfection parameters that were suitable for the detection of transcriptional regulation by a GFP reporter, we used as a model system the well-characterized regulation of CRE by cAMP-dependent protein kinase (PKA). Co-transfection of the catalytic subunit of PKA has previously been shown to increase CRE-containing luciferase and chloramphenicol acetyl transferase reporters (16, 17). Because initial experiments using standard plasmid DNA mixtures containing 510% of the transfected DNA as reporter did not show regulated GFP fluorescence, we used a wider range of ratios of reporter (pCRE-d2EGFP) and effector (pCMV.PKAß), increasing the range from 5% reporter and 90% effector to 90% reporter and 5% effector. As shown in Fig. 7, we found that the highest levels of regulation were obtained when the reporter construct constituted 50% or more of the plasmid DNA. This was surprising, because most reporter assays using solution transfection are optimized when the reporter is less than 10% of the total DNA transfected. The observation that reporter assays using STEP transfection were optimal when a majority of the DNA was reporter was also repeated with other reporter constructs, such as an Elk-1 reporter, a c-myc reporter, and a c-fos reporter (data not shown). We also found that when the effector plasmid was expressed as a linear PCR amplification cassette, regulation of the reporter plasmid by co-transfection of the PKA C subunit could be detected (Fig. 7). However, regulation was not observed if the reporter construct was generated as a linear amplification cassette (Fig. 7). Similar results were also found if the reporter plasmid DNA was linearized by restriction enzyme digestion. Thus it appears that supercoiling of the reporter plasmid is critical, while supercoiling of the effector plasmid is not. Co-transfection of an expression vector for PKA increased GFP expression by 2- to 5-fold. This induction was dependent on the presence of the CRE: the fluorescence resulting from transfection of the parental plasmid lacking CREs (pTAL-d2EGFP) was not detectable (data not shown).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7. Topological and proportion requirements of transcriptional reporter assay. Supercoiled plasmid DNA or PCR-generated linear fragments corresponding to CMV-PKAß or CRE-d2EGFP at the proportions indicated were STEP co-transfected into HEK-293T cells. Twenty-four hours after transfection, cells were fixed and GFP fluorescence was determined. White bars indicate the GFP fluorescence in cells co-transfected with the parental CMV.Neo expression vector, while black bars indicate the GFP fluorescence in cells transfected with the CMV.PKA expression vector. The fluorescence background of cells not transfected with reporter has been subtracted from all samples.
|
|
The dependence of the transcriptional regulation on co-expression of PKA was examined in more detail for three different transcriptional reporters containing function CREs. The CRE-d2EGFP reporter has two tandem copies of the CRE upstream of a minimal promoter driving expression of a proteolytically destabilized form of GFP. The c-fos-d2EGFP was constructed as described in "Materials and Methods," using 400 bp of the human c-fos promoter to drive expression of the destabilized d2EGFP (8). Finally, the c-fos EGFP was constructed in the pEGFP-1 reporter in which the GFP is not destabilized. Complexes were prepared with varying amounts of the PKA expression vector but with constant amounts of both the CRE-containing GFP reporter and an internal standard DsRed plasmid to control for transfection efficiency. As shown in Fig. 8, increasing the amount of PKA expression vector resulted in increasing GFP expression from all of the CRE-containing reporters. The CRE-d2EGFP reporter showed a low basal level of expression and a 2.1-fold induction by PKA. The c-fos-d2EGFP showed a significantly higher level of basal expression and a 2.9-fold induction. The higher basal level of expression seen for the c-fos-d2EGFP is likely due to the presence of additional transcription factor binding sites in the fos-d2EGFP reporter relative to the CRE-d2EGFP. Finally, the c-fos EGFP reporter demonstrated a 3.9-fold induction by PKA co-expression and a basal level of expression similar to that of the c-fos-d2EGFP. From these experiments and from studies with other promoters (data not shown), we concluded that the shorter proteolytic half-life of the destabilized form of GFP was not advantageous in STEP-mediated analysis of transcriptional regulation.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 8. Fluorescence of HEK-293T cells co-transfected with a PKA expression vector and the CRE reporter constructs. STEP complexes were generated containing varying amounts of PKA expression vector (0, 0.5, 1, 2.5, 5, and 10% of total DNA) and were spotted onto microscope slides. Panels AC relate to fluorescence micrographs of the fluorescent cells, and panel D relates to quantitation of the GFP reporter fluorescences. A, diagram indicating the placement of the individual STEP complexes on the microscope slide. B, DsRed fluorescence from the internal standard plasmid to control for transfection efficiency. C, GFP fluorescence from the c-fos EGFP reporter from the cells on the same spots in B. D, the c-fos-EGFP reporter containing the c-fos promoter directing the expression of GFP, the c-fos-d2EGFP reporter containing the cfos promoter driving expression of the destabilized form of GFP, and the CRE-d2EGFP containing two consensus CRE binding sites upstream of the basic TAL promoter were co-transfected with CMV.PKA into HEK-293T cells and fluorescence quantitated at 24 h after plating.
|
|
A major advantage of STEP transfection is the ease with which identical transfections can be carried out for different cell types or under different culture conditions. Fig. 9 shows the results of a time-course experiment with identical STEP complexes were prepared for transfection of HEK-293T (A) and N2A neuroblastoma (B). The c-fos promoter driving GFP expression was used in these experiments, and the amounts of PKA plasmid varied from 0 to 5%. Individual microscope slides with the transfected cells attached were fixed and scanned at 12, 24, or 36 h after plating the cells. Transfection with an enhancerless control vector (pTal-d2EGFP) showed no induction of expression (data not shown). The basal expression of the c-fos reporter increased over time in the HEK-293T cells. The maximal fold induction was 3.8-fold at 12 and 24 h after transfection, but only 2.7-fold after 36 h. In HEK-293T cells, the transfection was maximized at 2.5% effector, as there was no statistically significant difference in response for 2.5 and 10% effector.
In N2A cells (Fig. 9B), the basal level of expression of the fos promoter was approximately half that observed in HEK-293T cells, and the fold induction by PKA was less (2.3- versus 3.8-fold). The amount of PKA effector plasmid required for induction was also significantly greater for the N2A cells than for the HEK-293T cells (5 versus 2.5%). Because the complexes used in the transfection of these two cell types were identical, these results suggest that inherent differences in the signaling pathways of these two cell types results in differential responses to transfection of the PKA expression vector.
 |
DISCUSSION
|
|---|
In these studies, several proteins were shown to mediate high-efficiency transfection of DNAs in a microarray format. The proteins used here include the transferrin receptor, polylysine, adenoviral penton protein, and the HIV Tat protein, although it is clear from previous work that other proteins may also be able to mediate high-efficiency transfection (18, 19). The combinatorial use of different recombinant proteins in the spotted complexes should allow the generation of transfection complexes that are effective for a wide variety of cell types.
By using these proteins in STEP transfection, it was possible to demonstrate transcriptional regulation of a number of reporters by co-expression of the catalytic subunit of PKA. This was anticipated from the high co-transfection efficiency observed for STEP; however, the unusually high proportion of reporter plasmid required to demonstrate transcriptional regulation was not anticipated based on standard reporter assays using solution transfection. This suggests that other fundamental differences may exist between STEP transfection and solution transfection.
The magnitude of the regulation seen here is comparable to other reports of PKA regulation. For example, a c-fos luciferase construct was regulated 7-fold by co-transfection with a PKA expression vector (16), and a c-fos EGFP reporter was shown to be induced 4-fold by serum treatment (20). In our experiments, a reporter containing a simple CRE sequence was responsive to PKA co-transfection, but the native c-fos promoter showed a higher basal level of expression and greater ease of detection. In contrast to previous studies, our results show that the use of a destabilized form of the GFP protein was not advantageous over the wild-type protein. This may be due to the fact that the regulatory stimulus, overexpression of PKA, was present during the entire course of the experiment, while the previous studies used a shorter-term stimulation of the cells (21).
STEP transfection was developed using supercoiled plasmids for transfection, but linear expression cassettes coding for effector proteins also regulated reporter expression. However, CRE-containing linear reporter constructs were not effectively regulated under the same transfection conditions. This would suggest that supercoiling of reporter constructs is important for the recognition by the relevant transcription factors. The ability to use linear expression cassettes of effector proteins should facilitate rapid structure function analysis of protein kinases and other signaling proteins using PCR-based mutagenesis strategies.
In addition to the identification of other proteins with the ability to enhance transfection, the utility of STEP transfection will be enhanced by the development of increasingly quantitative and more-sensitive reporter assays. In addition to GFP and other fluorescent proteins, we have also tested ß-galactosidase, ß-lactamase, and alkaline phosphatase reporter constructs in STEP experiments. The GFP reporters currently offer the greatest reproducibility in assay of reporter expression, despite the greater sensitivity of these other enzymatic reporters.
STEP transfection has several advantages over classical transfection. First, the scale of the transfection allows the use of nanograms, instead of micrograms, of DNA in the transfection. This reduces both the time and material required for transfection analysis. Second, the throughput for microarray transfection is much higher than for conventional transfection, with 5005,000 transfections per slide. Third, because all the cells are incubated in the same culture media and all the cells plated are treated identically, comparison between different effector or reporter constructs is facilitated by the large number of individual transfection reactions that STEP allows. Finally, once multiple copies of transfection microarray slides are generated, these arrays can be used for transfection of multiple cell types.
Because of these advantages, the STEP transfection method has application in several types of functional genomic studies. For example, the specific physiological substrate proteins are not yet known for almost half of the protein kinases predicted in the human genome (22). Because many protein kinases do alter transcriptional regulation, STEP analysis should be useful in identifying transcription factors regulated by these kinases. STEP could also be applied in the analysis of the regulatory sequences for genes that are identified in microarray hybridization studies. For transcripts shown to be altered in expression in microarray hybridization studies, STEP transfection would facilitate subsequent analysis of the transcriptional regulatory sequences for the corresponding gene. Finally, a large number of functional microarray-based assays not involving transcriptional reporters, such as cellular differentiation assays, cytoskeletal reorganization, and cell adhesion assays, should be possible with the same STEP transfection methods described here to enhance high-throughput functional genomic studies.
 |
ACKNOWLEDGMENTS
|
|---|
We would like to acknowledge the assistance of Linda Harper in many of these experiments and the assistance of Dion Frischer in preparation of the manuscript.
 |
FOOTNOTES
|
|---|
Received, February 2, 2004, and in revised form, April 19, 2004.
Published, MCP Papers in Press, April 22, 2004, DOI 10.1074/mcp.M400018-MCP200.
1 The abbreviations used are: CREB, cAMP response element-binding protein; CMV, cytomegalovirus; CRE, cAMP response element; EGFP, enhanced green fluorescent protein; GFP, green fluorescent protein; HEK, human embryonic kidney; HIV, human immunodeficiency virus; PKA, cAMP-dependent protein kinase; STEP, surface transfection and expression protocol. 
* This work was supported by awards HG02367 and DK063340 from the National Institutes of Health (NIH) to M. D. U. and by a grant from the University of Michigan Medical School Technology Transfer Office. This work utilized the sequencing core of the Michigan Diabetes Research and Training Center funded by NIH5P60 DK20572 from the National Institute of Diabetes and Digestive and Kidney Diseases. Potential conflicts of interest between these NIH-sponsored research activities and activities related to Originus, Inc., are managed by the University of Michigan Medical School Conflict of Interest Committee. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
|| To whom correspondence should be addressed: Mental Health Research Institute, C560D MSRB2, 1150 W. Medical Center Drive, University of Michigan, Ann Arbor, MI 48109-0669. E-mail: muhler{at}umich.edu
 |
REFERENCES
|
|---|
- Brivanlou, A. H., and Darnell, J. E., Jr.
(2002) Signal transduction and the control of gene expression.
Science
295, 813
818[Abstract/Free Full Text]
- Lonze, B. E., and Ginty, D. D.
(2002) Function and regulation of CREB family transcription factors in the nervous system.
Neuron
35, 605
623[CrossRef][Medline]
- Lander, E. S., Linton, L. M, Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W.,
et al.
(2001) Initial sequencing and analysis of the human genome. Nature
409, 860
921[CrossRef][Medline]
- Levine, M., and Tjian, R.
(2003) Transcription regulation and animal diversity.
Nature
424, 147
151[CrossRef][Medline]
- Blanchette, M., and Tompa, M.
(2002) Discovery of regulatory elements by a computational method for phylogenetic footprinting.
Genome Res.
12, 739
748[Abstract/Free Full Text]
- Lenhard, B., Sandelin, A., Mendoza, L., Engstrom, P., Jareborg, N., and Wasserman, W. W.
(2003) Identification of conserved regulatory elements by comparative genome analysis.
J. Biol.
2, 13[CrossRef][Medline]
- Huggenvik, J. I., Collard, M. W., Stofko, R. E., Seasholtz, A. F., and Uhler, M. D.
(1991) Regulation of the human enkephalin promoter by two isoforms of the catalytic subunit of cyclic adenosine 3',5'-monophosphate-dependent protein kinase.
Mol. Endocrinol.
5, 921
930[Abstract]
- Bingham, A. H., Bruton, C. J., and Atkinson, T.
(1979) Isolation and partial characterization of four plasmids from antibiotic-resistant thermophilic bacilli.
J. Gen. Microbiol.
114, 401
408[Medline]
- Ziauddin, J., and Sabatini, D. M.
(2001) Microarrays of cells expressing defined cDNAs.
Nature
411, 107
110[CrossRef][Medline]
- Wagner, E., Zenke, M., Cotten, M., Beug, H., and Birnstiel, M. L.
(1990) Transferrin-polycation conjugates as carriers for DNA uptake into cells.
Proc. Natl. Acad. Sci. U. S. A.
87, 3410
3414[Abstract/Free Full Text]
- Medina-Kauwe, L. K., Maguire, M., Kasahara, N., and Kedes, L.
(2001) Nonviral gene delivery to human breast cancer cells by targeted Ad5 penton proteins.
Gene Ther.
8, 1753
1761[CrossRef][Medline]
- Ignatovich, I. A., Dizhe, E. B., Pavlotskaya, A. V., Akifiev, B. N., Burov, S. V., Orlov, S. V., and Perevozchikov, A. P.
(2003) Complexes of plasmid DNA with basic domain 4757 of the HIV-1 Tat protein are transferred to mammalian cells by endocytosis-mediated pathways.
J. Biol. Chem.
278, 42625
42636[Abstract/Free Full Text]
- Haapasalo, A., Saarelainen, T., Moshnyakov, M., Arumae, U., Kiema, T. R., Saarma, M., Wong, G., and Castren, E.
(1999) Expression of the naturally occurring truncated trkB neurotrophin receptor induces outgrowth of filopodia and processes in neuroblastoma cells.
Oncogene
18, 1285
1296[CrossRef][Medline]
- Burton, D. Y., Song, C., Fishbein, I., Hazelwood, S., Li, Q., DeFelice, S., Connolly, J. M., Perlstein, I., Coulter, D. A., and Levy, R. J.
(2003) The incorporation of an ion channel gene mutation associated with the long QT syndrome (Q9E-hMiRP1) in a plasmid vector for site-specific arrhythmia gene therapy:
In vitroand in vivofeasibility studies. Hum. Gene Ther.
14, 907
922[CrossRef][Medline]
- Liang, X., Teng, A., Braun, D. M., Felgner, J., Wang, Y., Baker, S. I., Chen, S., Zelphati, O., and Felgner, P. L.
(2002) Transcriptionally active polymerase chain reaction (TAP): High throughput gene expression using genome sequence data.
J. Biol. Chem.
277, 3593
3598[Abstract/Free Full Text]
- Mellon, P. L., Clegg, C. H., Correll, L. A., and McKnight, G. S.
(1989) Regulation of transcription by cyclic AMP-dependent protein kinase.
Proc. Natl. Acad. Sci. U. S. A.
86, 4887
4891[Abstract/Free Full Text]
- Gamm, D. M., Baude, E. J., and Uhler, M. D.
(1996) The major catalytic subunit isoforms of cAMP-dependent protein kinase have distinct biochemical properties in vitro and in vivo.
J. Biol. Chem.
271, 15736
15742[Abstract/Free Full Text]
- Carlisle, R. C.
(2002) Use of adenovirus proteins to enhance the transfection activity of synthetic gene delivery systems.
Curr. Opin. Mol. Ther.
4, 306
312[Medline]
- Kichler, A., Pages, J. C., Leborgne, C., Druillennec, S., Lenoir, C., Coulaud, D., Delain, E., Le Cam, E., Roques, B. P., and Danos, O.
(2000) Efficient DNA transfection mediated by the C-terminal domain of human immunodeficiency virus type 1 viral protein R.
J. Virol.
74, 5424
5431[Abstract/Free Full Text]
- Bi, J. X., Wirth, M., Beer, C., Kim, E. J., Gu, M. B., and Zeng, A. P.
(2002) Dynamic characterization of recombinant Chinese hamster ovary cells containing an inducible c-fos promoter GFP expression system as a biomarker.
J. Biotechnol.
93, 231
242[CrossRef][Medline]
- Li, X., Zhao, X., Fang, Y., Jiang, X., Duong, T., Fan, C., Huang, C. C., and Kain, S. R.
(1998) Generation of destabilized green fluorescent protein as a transcription reporter.
J. Biol. Chem.
273, 34970
34975[Abstract/Free Full Text]
- Manning, G., Whyte, D. B., Martinez, R., Hunter, T., and Sudarsanam, S.
(2002) The protein kinase complement of the human genome.
Science
298, 1912
1934[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. Hodges, J. S. Redelius, W. Wu, and C. Hoog
Accelerated Discovery of Novel Protein Function in Cultured Human Cells
Mol. Cell. Proteomics,
September 1, 2005;
4(9):
1319 - 1327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. OVCHARENKO, R. JARVIS, S. HUNICKE-SMITH, K. KELNAR, and D. BROWN
High-throughput RNAi screening in vitro: From cell lines to primary cells
RNA,
June 1, 2005;
11(6):
985 - 993.
[Abstract]
[Full Text]
[PDF]
|
 |
|