Originally published In Press as doi:10.1074/mcp.M500239-MCP200 on October 31, 2005.
Molecular & Cellular Proteomics 5:245-255, 2006.
© 2006 by The American Society for Biochemistry and Molecular Biology, Inc.
Research
A Novel Subtractive Antibody Phage Display Method to Discover Disease Markers*
Daniëlle Hof ,
Kalok Cheung ,
Hilde E. Roossien ,
Ger J. M. Pruijn and
Jos M. H. Raats , ,¶
From the Department of Biochemistry, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen, NL-6500 HB Nijmegen, The Netherlands and ModiQuest B. V., NL-6525 GA Nijmegen, The Netherlands
 |
ABSTRACT
|
|---|
Todays research demands fast identification of potential diagnostic and therapeutic targets. We describe a novel phage display strategy to identify disease-related proteins that are specifically expressed in a certain (diseased) tissue or cells. Phages displaying antibody fragments are selected on complex protein mixtures in a two-step manner combining subtractive selection in solution with further enrichment of specific phages on two-dimensional Western blots. Targets recognized by the resulting recombinant antibodies are immunoaffinity-purified and identified by mass spectrometry. We used antibody fragment libraries from autoimmune patients to discover apoptosis-specific and disease-related targets. One of the three identified targets is the U1-70K protein, a marker for systemic lupus erythematosus overlap disease. Interestingly the epitope on U1-70K recognized by the selected recombinant antibody was shown to be apoptosis-dependent, and such epitopes are believed to be involved in breaking tolerance to self-antigens. The other two proteins were identified as polypyrimidine tract-binding protein-associated splicing factor (PSF)/nuclear RNA- and DNA-binding protein of 54 kDa (p54nrb) and heterogeneous ribonucleoprotein C.
In the postgenomic era where the human genome is completely sequenced and available in databases, it became clear that having the complete genome sequence is not enough to reveal biological function. For example, mRNA levels do not necessarily correlate with the expression levels of the corresponding proteins, and the relative levels of protein variants resulting from either alternative splicing or posttranslational modifications cannot be predicted from the gene sequence. "Proteomics" defines a broad area of interest and is aimed at protein identification; studying protein function, posttranslational modifications, and protein-protein interactions; and finding molecular drug targets (1). Such molecular drug targets can be proteins that are specifically present in a diseased tissue or cell. One approach to discover "proteome-specific" proteins is to compare the proteome of a diseased cell or tissue with the proteome of the same cell or tissue in a normal (non-diseased) state. This is commonly done by two-dimensional gel electrophoresis and mass spectrometry. Such an approach generally leads to an (extensive) list of proteins that are up- or down-regulated or modified in various ways. To subsequently find the proteins that are actually relevant for disease is a difficult and laborious task. Phage display, first described by George Smith (2) in 1985, is a powerful technique based on the display of proteins or peptides on the surface of phage particles that carry the corresponding gene. In proteomics, phage display offers an elegant approach in the search for disease markers. Subtractive antibody selections have been successfully performed on whole cells (310), tissue sections (11), biomaterials ex vivo (12), and cell extracts (1319). A major advantage of subtractive phage display technology is the simultaneous generation of recombinant monoclonal antibodies recognizing potential disease markers. Such antigen-antibody pairs could be directly applicable in therapeutics or diagnostics.
Here we present a novel subtractive antibody phage display method that enables the identification of proteome-specific, intracellular epitopes. As schematically represented in Fig. 1, the selection method comprises two steps. In the first step, phages are selected in solution on the proteome of interest with prior subtraction on a comparable "normal" proteome (Fig. 1, a and b). Biotinylation of the proteomes allows their immobilization on magnetic streptavidin-coated beads. In the second phase, specific phages from the phage pool, which is enriched for phages to proteome-specific epitopes in the first step, are further selected on a two-dimensional Western blot of the proteome of interest (Fig. 1c). After identification of proteome-specific phages, their targets are immunoaffinity-purified using these recombinant antibodies and identified by means of mass spectrometry. The use of immune libraries (for example libraries from autoimmune patients) will enhance the chances of discovering disease-related epitopes because these libraries will contain high affinity antibodies against disease markers. In systemic autoimmune diseases, it still remains poorly understood why patients produce antibodies to self-antigens. One (more and more supported) theory points at the involvement of aberrant protein modifications, for example those occurring during apoptosis. Such modifications are believed to reveal "cryptic" epitopes on autoantigens and as such play a role in breaking tolerance to self-antigens (2022). In the current study, the subtractive phage display selection method was applied, using autoimmune patient antibody libraries, to identify apoptosis-specific epitopes relevant for systemic autoimmune diseases. Three epitopes were identified that are exclusively present in the apoptotic cell extract. One of these epitopes is associated with the U1-70K1 protein, which is cleaved during apoptosis and which is an important marker for systemic lupus erythematosus (SLE) overlap disease. Finally we demonstrate that the recognition of this epitope by the selected antibody was dependent on the apoptotic modification.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1. Schematic representation of the selection strategy. The selection strategy is a combination of several subtractive selection rounds on proteomes in solution followed by an enrichment step on immunoblot. Phages are selected on biotinylated proteomes with subsequent capture by magnetic streptavidin-coated beads. Phages recognizing common epitopes are first removed by a subtractive selection on the comparable normal proteome (a), and subsequently remaining phages are selected on epitopes that are specifically present in the proteome of interest (b). These selection rounds are repeated several times. Subsequently Western blots containing both proteomes are incubated with the selected phage pool enriched for antibodies to proteome-specific epitopes (c). Spots are excised from the membrane, and bound phages are eluted and used to infect bacterial cultures to isolate monoclonal phages. Finally these phages are screened for recognition of proteome-specific epitopes.
|
|
 |
EXPERIMENTAL PROCEDURES
|
|---|
Phage Display Libraries and Patient Sera
Patients were classified in accordance with standard criteria for each autoimmune disease. Autoimmune patient libraries of SLE (patients D5, D18, D181, O11, and Z5), systemic sclerosis (SSc) (patients B92, H248, J70, S185, and T5), and rheumatoid arthritis (RA) (patients Du, He, and Wy) patients were available in pHenIX-VSV vector format (2325). The synthetic library made by Nissim et al. (26) was used for test selections. To reduce the background of phages that do not express a functional antibody-gene III fusion protein and to reduce the number of selection rounds needed, a trypsin-sensitive helper phage (27) was used for phage amplification. Serum samples were provided by patients seen at the Department of Rheumatology and Internal Medicine of the Radboud University Nijmegen Medical Centre (Nijmegen, The Netherlands).
Cell Lines, Induction of Cell Death, and Preparation of Cell Extracts
Jurkat (human T cell leukemia) suspension cells were grown in RPMI 1640 medium (Invitrogen) supplemented with 1 mM sodium pyruvate, 1 mM penicillin, 1 mM streptomycin, and 10% heat-inactivated FCS (Invitrogen) in a humidified 37 °C incubator containing 5% CO2. Jurkat cells were maintained at a concentration of 1 x 106 cells/ml. HeLa cells were either purchased from Computer Cell Culture Centre (Mons, Belgium), or HeLa suspension cells were grown in suspension culture minimal essential medium with Joklik modification (Oxoid) supplemented with non-essential amino acids (Invitrogen), 5% newborn serum (NBS, Invitrogen), 2 mM L-glutamine (Invitrogen), 1 mM penicillin, and 1 mM streptomycin. Apoptosis was induced in Jurkat and HeLa cells by addition of 10 µg/ml anisomycin. Eight hours after induction, cells were harvested by centrifugation at 800 x g for 5 min and washed with PBS. Non-apoptotic HeLa cytoplasmic extract was prepared as described previously (28). Cell extracts were prepared by three different methods: (i) cells were resuspended in PBS and lysed by freezing-thawing, (ii) cells were resuspended in lysis buffer (50 mM Tris-HCl, pH 7.6, 100 mM KCl, 0.05% Nonidet-P40, 1 mM EDTA, and 1 mM dithioerythritol (DTE)) and lysed by sonication, or (iii) cells were resuspended in Nonidet P-40 lysis buffer (25 mM Tris-HCl, pH 7.6, 100 mM KCl, 1% Nonidet P-40, 10 mM MgCl2, and 0.25 mM DTE) and lysed on ice for 30 min. Cell lysates were prepared at a concentration of 0.51 x 108 cells/ml on ice in the presence of protease inhibitors (CompleteTM protease inhibitor mixture (Roche Applied Science)). After cell lysis, extracts were centrifuged at 12,000 x g at 4 °C for 30 min, and clear lysates were stored at 70 °C. Three milligrams of cell extract (soluble proteins) were biotinylated with 150 µg of succinimidyl-6-(biotinamido) hexanoate (Pierce) in 50 mM NaHCO3, pH 8.3, and dialyzed against 0.5 mM DTE and 20% glycerol in PBS. The protein concentration of the biotinylated cell extract was measured using a bicinchoninic acid (BCA) protein assay (Pierce) with BSA as a standard, and the amount of magnetic streptavidin beads (DYNAL Biotech) needed to completely capture a given amount of biotinylated cell extract was established empirically.
Protein Electrophoresis and Immunoblotting
Proteins were separated by one- or two-dimensional electrophoresis. For isoelectric focusing immobilized pH gradient strips were used (Amersham Biosciences). Proteins were stained with colloidal Coomassie (Serva) or by silver staining. Alternatively proteins were transferred to a nitrocellulose (Schleicher & Schuell) or PVDF (Millipore) membrane by electroblotting. For immunoblotting, all incubation steps were carried out at room temperature on a shaking table. Blocking solutions consisted of PBS, 0.05% Tween 20, and either 5% nonfat dried milk powder or 1% gelatin. Gelatin was only applied when phages were used for detection. scFv fragments were isolated from Escherichia coli periplasm (29) and used at a 5100-fold dilution. Bound scFv fragments were detected using a mouse anti-VSV-G monoclonal antibody in combination with horseradish peroxidase (HRP)-labeled rabbit anti-mouse antibodies followed by ECL. Phages were incubated with the membrane at a concentration of 1011 cfu/ml. After extensive washing, bound phages were detected with HRP-conjugated anti-M13 mouse monoclonal antibody (Amersham Biosciences) followed by 3,3',5,5'-tetramethylbenzidine (TMB, Neogen) staining (30) or ECL.
Phage Selection
Test Selections on Biotinylated HeLa Cytoplasmic Cell Extract
To test whether selection against biotinylated cell extract was promising, anti-La and anti-Ro52 phages, previously selected from human autoimmune patient derived libraries (24),2 were diluted in a semisynthetic (Nissim) phagemid library at two different ratios, namely a 1:106 ratio and a 1:109 ratio. For a 1:106 ratio 107 anti-La and 107 anti-Ro52 phages were simultaneously mixed with 1013 phages of the semisynthetic library, and for a 1:109 ratio 104 anti-La and 104 anti-Ro52 were simultaneously mixed with 1013 phages of the semisynthetic library. All panning steps were performed using an end-over-end rotator at room temperature. First the phages were incubated with 1 mg of magnetic streptavidin beads, which were preblocked in PBS containing 5% nonfat dried milk powder and 1% BSA, for 1 h. Beads were magnetically separated from the solution and discarded, whereas the solution containing the remaining phages was transferred to a clean tube. Subsequently phages were incubated with 1.5 µg of biotinylated normal HeLa cytoplasmic cell extract for 1 h, 1 mg of preblocked magnetic streptavidin beads were added, and the mixture was rotated for 15 min. Beads were magnetically harvested from the solution and washed several times with PBS containing 0.05% Tween 20 (PBST) and twice with PBS. Bound phages were eluted by incubating the washed beads in 1 ml of trypsin (10 g/liter in PBS, pH 7.4, and prewarmed at 37 °C) for 30 min at room temperature. Beads were harvested and discarded, whereas the solution containing the eluted phages was transferred to a clean tube and incubated with 1 ml of NBS for 5 min to inhibit trypsin activity. Phages were amplified using trypsin-sensitive helper phage and purified from the medium by polyethylene glycol precipitation as described previously (31).
Polyclonal Phage ELISA
Polyclonal phage pools of each round were screened in ELISA for reactivity with La and Ro52 and against BSA as a control. Antigens were coated on 96-well Maxisorb microtiter plates (Nunc) at a concentration of 0.1 µg/well in 100 µl of 50 mM NaHCO3, pH 9.3, overnight at 4 °C. Plates were blocked with 400 µl of 5% nonfat dried milk powder in PBS (MPBS) containing 0.05% Tween 20 (MPBST) per well at room temperature for 2 h. Phages were diluted in MPBST at a concentration of 1011 cfu/ml, and 100 µl were incubated at room temperature for 1 h. The plates were washed eight times with PBST, and subsequently HRP-conjugated anti-M13 mAb (Amersham Biosciences) was added at a 5,000-fold dilution in MPBST and incubated at room temperature for 1 h. Plates were washed eight times with PBST and twice with PBS. Bound HRP-conjugated antibodies were detected by TMB conversion. Reactions were stopped with 1 M H2SO4, and the absorbance at 450 nm was measured.
Subtractive Selection against Biotinylated Apoptotic Cell Extract
Libraries of RA, SLE, and SSc patients were mixed equally and used for selection. All panning steps were performed using an end-over-end rotator at room temperature. First the phages were incubated with 1 mg of magnetic streptavidin beads, which were preblocked with 5% nonfat dried milk powder and 1% BSA in PBS, for 1 h. Beads were magnetically separated from the solution and discarded, whereas the solution containing the remaining phages was transferred to a clean tube. To subtract phages recognizing normal cell extract components, phages were incubated with 1.5 µg of biotinylated non-apoptotic HeLa cytoplasmic cell extract for 1 h, 1 mg of preblocked magnetic streptavidin beads were added, and the mixture was rotated for 15 min. Beads were harvested and discarded, and the remaining phage solution was transferred to a clean tube. This subtraction step was repeated with another 1.5 µg of biotinylated non-apoptotic HeLa cytoplasmic cell extract and 1 mg of preblocked beads. Remaining phages were again transferred to a clean tube. Subsequently phages specifically recognizing apoptotic cell extract components were selected by panning against 1.5 µg of biotinylated apoptotic HeLa cell extract for 1 h. One milligram of preblocked magnetic streptavidin beads was added, and the mixture was rotated for 15 min. Beads were harvested and washed several times with PBST and twice with PBS, and bound phages were eluted by incubating the beads in 1 ml of trypsin (10 mg/ml in PBS, pH 7.4) for 30 min. Beads were discarded, and eluted phages were incubated with 1 ml of NBS and immediately used to infect exponentially growing E. coli TG1. Phages were then amplified and purified as described above.
Selection of Enriched Phage Populations on Two-dimensional Western Blots
After three subtractive selection rounds on biotinylated apoptotic cell extract as described above, polyclonal phage pools of each round were analyzed on Western blots of two-dimensional gels containing apoptotic and non-apoptotic cell extracts as described above. The phage stock from the third round showed the highest signals and most differences between apoptotic and non-apoptotic extracts. To specifically select phages recognizing a protein spot that was differentially recognized in apoptotic versus non-apoptotic cell extracts, Western blot membranes of two-dimensional gels were incubated with the phage stock from the third selection round as described above. Directly after visualization of bound phages, the membrane was covered with PBS, and membrane spots of interest were accurately excised using a clean razor blade for each spot. TMB staining resulted in a blue precipitate on the membrane, allowing highly accurate excision of spots. For ECL detection, the film was placed on a light box and overlaid exactly with the membrane. Bound phages were eluted from the excised spots by incubating the blot piece in 100 mM triethylamine (TEA), transferred to a clean tube, and neutralized with 1 M Tris-HCl, pH 7.4. The eluted phages were subsequently treated with trypsin, as described above, to reduce background. Finally phages were used to infect exponentially growing E. coli TG1 and plated on square (12 x 12-cm) 2x tryptone/yeast extract agar plates containing 100 µg/ml ampicillin and 2% glucose.
Screening of Single Colonies
Single colonies were analyzed for VSV-G expression by a dot blot assay and for full-length DNA by PCR using primers LMB3 (CAGGAAACAGCTATGACCATG) and FdSeq1 (GTAACGATCTAAAGTTTTGTCG). Full-length clones with good expression levels were fingerprinted with the restriction enzyme BstNI. From all unique fingerprint clones with good expression, phages were produced in 2-ml-deep-well microtiter plates. Undiluted culture supernatants containing phage were screened on Western blots of SDS-PAGE gels containing non-apoptotic and apoptotic cell extracts. Phages were detected with HRP-labeled anti-M13 mAb as described above. Several phages recognized proteins that were differentially present between non-apoptotic and apoptotic cell extracts. Three clones were chosen for further analysis, and their cDNAs were sequenced as described previously (32).
Immunoaffinity Purification and Identification of Target Antigens
scFv fragments were C-terminally tagged with a His6 tag by cloning the cDNA in a pUC119 vector (31) via compatible NcoI and NotI digestion. Recombinant scFv antibody fragments were isolated from 80 ml of E. coli periplasm as described previously (29) and dialyzed against p-IPP500 (50 mM phosphate buffer, pH 8.0, 500 mM NaCl). All steps were performed at 4 °C using an end-over-end rotator. The scFv solution was incubated with 50 µl of nickel-nitrilotriacetic acid-agarose beads (50% slurry, Qiagen) for 2 h. Subsequently beads were washed three times with 15 ml of p-IPP500 and three times with 15 ml of p-IPP150 (50 mM phosphate buffer, pH 8.0, 150 mM NaCl). Beads were incubated with cell extract of 5 x 107 cells, prepared by sonication, at a concentration of 5 x 107 cells/ml for 2 h. Beads were washed three times with p-IPP150. To remove nonspecifically bound proteins, beads were incubated with 10 ml of 5 mM imidazole for 10 min, and the supernatant was discarded. Beads were transferred to a clean tube and incubated with 30 µl of 100 mM TEA for 10 min. The supernatant was transferred to a clean tube, and elution was repeated with 30 µl of 100 mM TEA. The supernatant was pooled with the first supernatant and neutralized with 20 µl of 1 M Tris-HCl, pH 7.4. The proteins were concentrated by acetone precipitation and separated on a polyacrylamide gel. The gel was stained with colloidal Coomassie (Serva). Protein bands were cut out and digested in-gel with trypsin. Peptides were then eluted from the gel slice and subjected to MALDI-TOF mass spectrometric analysis.
Immunofluorescence
HeLa cells were grown directly on glass slides. Cells were fixed using methanol/acetone or p-formaldehyde (33). scFv fragments were purified and concentrated from periplasmic fractions using the His6 tag as described previously (24) and incubated with the cells. Bound scFv fragments were detected via their VSV-G tag using anti-VSV-G mouse monoclonal antibody (500-fold diluted in PBS) followed by FITC-labeled rabbit anti-mouse antibody (Dako; 50-fold diluted in PBS). Finally cells were embedded in Mowiol and analyzed using a fluorescence microscope.
U1 snRNP Immunoprecipitation
All incubations were performed in t-IPP150 (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Nonidet P-40) at 4 °C using an end-over-end rotator. Between incubations, beads were washed three times with t-IPP150. Protein A-agarose beads (20 µl of 50% slurry, Kem-En-Tec) were precoated with 12.5 µl of rabbit anti-mouse IgG (Dako) for 2 h and subsequently coated with 50 µl of mouse anti-VSV-G mAb for 2 h. Then beads were incubated with 5 ml of concentrated solution of VSV-G-tagged recombinant scFv antibody fragments isolated from E. coli periplasm as described above. Finally beads were incubated with 60 µl of 1 x 108 cells/ml Jurkat apoptotic or non-apoptotic cell extract prepared by lysis in Nonidet P-40 lysis buffer as described above for 2 h. Mouse mAb 2.73 directed against U1-70K protein was used as a positive control. Anti-BSA scFv, previously selected from an SLE patient library,2 was used as a negative control. Finally beads were resuspended in 100 µl of t-IPP150 containing 0.5% SDS, and co-immunoprecipitated RNA was isolated by addition of TRIzol reagent (Invitrogen) according to the manufacturers protocol. Isolated RNA was subsequently size-fractionated on 6% polyacrylamide, 8 M urea gels and transferred to a nylon membrane (HybondTM-N, Amersham Biosciences) by Northern blotting. Finally U1 RNA was detected using a 32P-labeled U1 RNA-specific antisense probe and analyzed by autoradiography. The signals were quantified using a ScanMaker 8700 (Microtek). The U1 snRNA was isolated from the apoptotic and non-apoptotic Jurkat cells as well and size-fractionated on the same gel (10% of the input material).
 |
RESULTS
|
|---|
Test Selections on Biotinylated Cytoplasmic HeLa Cell Extracts
Successful selections against complex mixtures of antigens, such as a cellular extracts, depend on many factors (34), including the amount and concentration of antigen and the affinity of the antibody fragments. Selection conditions were tested by means of mock selections. A semisynthetic antibody phage library was simultaneously spiked with phages displaying monoclonal antibody fragments recognizing the autoantigens La and Ro52 previously selected from SLE-derived libraries (24)2 at various ratios. The 1:109 ratio approximated the complexity of the libraries used in subsequent experiments. After selection on biotinylated cytoplasmic HeLa cell extract, the polyclonal phage pools were tested in ELISA for reactivity against La and Ro52 and against BSA as a control antigen. As shown in Fig. 2, at a 1:106 ratio anti-La phages were detectably enriched after just one selection round, whereas at a 1:109 ratio anti-La phages were detected after two rounds of panning. At a 1:106 ratio the polyclonal phage stock showed slight reactivity with Ro52, whereas at a 1:109 ratio no reactivity against Ro52 was observed after two selection rounds. After three selection rounds, 96 monoclonal phages were analyzed for reactivity in ELISA, and 27% of the phages reacted with La, whereas 10% were positive for Ro52. It has been estimated that, in HeLa cells, the number of Ro52 molecules is about 100-fold smaller than the number of La molecules (35); this might explain why the anti-La phages were more easily isolated than the anti-Ro52 phages. These results demonstrate that it is possible to select phage antibodies from libraries derived from autoimmune patients using only small amounts of biotinylated cell extract.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2. Test selections of polyclonal phages using biotinylated cytoplasmic HeLa cell extract. In the test selections, anti-La and anti-Ro52 phages were simultaneously added to a semisynthetic library at a 1:109 ratio (a) and at a 1:106 ratio (b), selected on 1.5 µg of biotinylated cytoplasmic HeLa cell extract, and captured using magnetic streptavidin-coated beads. The phage populations resulting from the selection rounds were tested for binding to La and Ro52. BSA was used as a negative control. Selection rounds are numbered (0, 1, and 2). Per well 0.1 µg of recombinant protein was coated. Polyclonal phage pools were diluted to a concentration of 1011 cfu/ml and detected using HRP-labeled anti-M13 mAb. The ELISA plates were developed with TMB as a substrate, and after the addition of H2SO4, the absorption at 450 nm was measured.
|
|
Subtractive Selection of Recombinant Antibodies against Apoptosis-specific Epitopes
To induce apoptosis, HeLa and Jurkat cells were incubated with anisomycin for 8 h. As a biochemical marker for apoptosis the cleavage of the U1-70K protein to a 40-kDa apoptosis-specific fragment, an early event during apoptosis (36), was monitored. Eight hours after induction with anisomycin, the apoptotic 40-kDa fragment was detected by immunoblotting, whereas the full-length 70-kDa protein was reduced to undetectable levels (data not shown), indicating that the cells had entered the apoptotic pathway.
Libraries of RA, SSc, and SLE patients (2325) were mixed using equal amounts of phages from each library, and phages were selected for reactivity with apoptosis-specific epitopes by subtractive selection as detailed under "Experimental Procedures." After three selection rounds, phage populations of each selection round were analyzed on small two-dimensional Western blots containing non-apoptotic and apoptotic cell extracts. The polyclonal phage stock obtained after the third selection round showed the strongest reactivity on Western blot and was chosen for further analysis (Fig. 3). Several of the apoptosis-specific spots were excised, and bound phages were eluted. Both ECL detection and TMB staining were examined as detection methods. Where TMB staining is more accurate (due to a direct precipitate on the membrane), ECL detection resulted in a higher sensitivity. The amount of phages eluted from ECL-detected spots was approximately equal to the amount of phages eluted from TMB-stained spots, and no negative effect on phage infectivity was observed for both staining methods. On average, 100 phages were eluted per spot. Phages were selected based on full-length cDNA insert and expression of soluble scFv. Fingerprint analysis of phages with full-length cDNA and good scFv expression resulted in the identification of a number of groups, and randomly one clone per group was analyzed for reactivity on immunoblot containing both extracts. All scFv fragments were derived from their original spots.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3. Selection of isolated phages by two-dimensional Western blotting. Apoptosis was induced in HeLa cells by incubation in the presence of anisomycin for 8 h, and apoptotic cell extract was prepared by repeated freeze-thawing. Approximately 40 µg of non-apoptotic cytoplasmic HeLa cell extract (a) and apoptotic HeLa cell extract (b) were separated by two-dimensional electrophoresis. In the first dimension, proteins were separated by isoelectric focusing on immobilized pH gradients with a pH range from 3 to 10, and in the second dimension, proteins were separated by SDS-PAGE on a 12.5% polyacrylamide gel. Molecular masses of marker proteins (kDa) are indicated on the left. After two-dimensional electrophoresis, proteins were transferred to a nitrocellulose membrane, and the membrane was blocked with MPBST. Prior to the immunoblot analysis, phages were selected during three consecutive subtractive selection rounds on biotinylated apoptotic cell extract. Phages were incubated with the preblocked membrane at a concentration of 5 x 1011 cfu/ml and detected with HRP-labeled anti-M13 mAb and ECL. Between antibody incubations, the membrane was washed extensively with MPBST to reduce background on the film. A similar (TMB-stained) membrane was used for excision of apoptosis-specific spots.
|
|
Immunoblot analysis, as shown in Fig. 4, demonstrated that scFv fragments B1H11, G1G10, and R3A4 recognized antigens that are modified during apoptosis. scFv B1H11 recognized protein bands of 100, 55, and 45 kDa in non-apoptotic cell extract and two additional protein bands of 50 and 42 kDa in apoptotic cell extract. Another additional protein band, which ran slightly faster than the 100-kDa protein band, was relatively weakly recognized. scFv G1G10 reacted with a protein of 38 kDa that migrated at a slightly lower molecular mass in apoptotic cell extract compared with non-apoptotic cell extract. scFv R3A4 recognized a protein band of 70 kDa in non-apoptotic cell extract and a protein band of about 40 kDa in apoptotic cell extract.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4. Characterization of the reactivities of the selected monoclonal recombinant antibodies. ac, immunoblotting. Apoptosis was induced in Jurkat cells by incubation with anisomycin for 8 h. Cell extracts were prepared by sonication. Approximately 10 µg of apoptotic (a) and non-apoptotic (n) Jurkat cell extract was separated by SDS-PAGE on a 12.5% polyacrylamide gel and electroblotted onto nitrocellulose membranes. Molecular masses of marker proteins (kDa) are indicated on the left. scFv fragments were isolated from the periplasm. scFv fragments B1H11 and R3A4 were incubated with the membrane at a 10-fold dilution, and scFv G1G10 was incubated with the membrane at a 20-fold dilution. scFv B1H11 (a) recognizes protein bands of 100, 55, and 45 kDa in non-apoptotic cell extract and additional strong protein bands of 50 and 42 kDa in apoptotic cell extract. Another additional protein band, running slightly faster than the 100-kDa band, is recognized relatively more weakly. scFv G1G10 (b) reacts with a protein band of 38 kDa in non-apoptotic cell extract and with a protein band of 37 kDa in apoptotic cell extract. scFv R3A4 (c) recognizes a protein band of 70 kDa in non-apoptotic cell extract and a 40-kDa protein band in apoptotic cell extract. Note that the reactivity with the apoptotic form of this protein is stronger than the reactivity with the non-apoptotic form. eg, immunofluorescence. HeLa monolayer cells were fixed and incubated with purified scFv fragments. Bound scFv fragments were detected by anti-VSV-G mAb and FITC-labeled rabbit anti-mouse antibodies. scFv fragments B1H11 (e), G1G10 (f), and R3A4 (g) all give a nucleoplasmic staining. d, immunoaffinity purification. scFv fragments G1G10 (lane 1) and B1H11 (lane 2), recloned in a pUC119 vector for C-terminal fusion with a His6 tag, were isolated from E. coli periplasm. scFv fragments were coupled to nickel-nitrilotriacetic acid-agarose beads and incubated with non-apoptotic total cell extracts, and bound antigens were eluted by a pH shock. The proteins were concentrated by acetone precipitation, separated on a small 12.5% polyacrylamide gel, and visualized by silver staining. Molecular masses of marker proteins (kDa) are indicated on the left. The strong protein bands with an approximate molecular mass of 30 kDa are the scFv fragments. A similar gel stained with colloidal Coomassie was used to excise and identify the protein bands of interest. Arrows indicate the excised protein bands.
|
|
Identification of Target Antigens
The recombinant antibodies, isolated during the selection procedure, can serve as tools to identify and characterize the corresponding target antigens. scFv fragments were C-terminally tagged with a His6 tag and immobilized on nickel beads, and target proteins were then isolated from cell extracts and separated on SDS-PAGE gels. As shown in Fig. 4g, scFv B1H11 efficiently immunoprecipitated proteins with molecular weights corresponding to those detected by immunoblotting, whereas immunoaffinity purification of the target recognized by scFv G1G10 appeared to be less efficient. These protein bands were excised from the gel, and the proteins in the gel slices were identified by mass spectrometry. An overview of the selected targets and their characteristics are presented in Table I.
View this table:
[in this window]
[in a new window]
|
TABLE I Overview of selected targets
IFA, immunofluorescence assay; WB, western blot; IP, immunoprecipitation; rec. antigen, reactivity with recombinant antigen; a.o., among others.
|
|
The proteins recognized by scFv B1H11 were identified as polypyrimidine tract-binding protein-associated splicing factor (PSF, 100 kDa) and p54 nuclear RNA- and DNA-binding protein (p54nrb, 54 kDa). The scFv recognizes both PSF and p54nrb on immunoblot, indicating that the epitope recognized by this scFv is present on both proteins. In agreement with this, the two proteins are 70% identical on the level of amino acids over a region of 328 residues, strongly suggesting that the epitope is located in this region of these molecules. Interestingly it has been reported that PSF is hyperphosphorylated (37) and p54nrb is cleaved (38) during apoptosis. Cleavage of p54nrb leads to a size reduction of 4 kDa, which agrees well with the apoptosis-specific protein band of 50 kDa (Fig. 4a). The 45-kDa protein band in non-apoptotic cell extract is presumably either a splicing variant or degradation product of p54nrb. Also this variant seems to be cleaved in apoptotic cells leading to the appearance of the 42-kDa species, which is also recognized by scFv B1H11. In agreement with the nuclear localization of PSF and p54nrb, immunofluorescence analysis of scFv B1H11 demonstrated a nucleoplasmic staining (Fig. 4e).
The protein recognized by scFv G1G10 was identified by mass spectrometric analysis as heterogeneous nuclear ribonucleoprotein C (hnRNP C). As a result of alternative splicing, two variants of hnRNP C can be detected in most cells, designated C1 and C2, that differ 3 kDa in size (39). The identity of the G1G10 target protein was confirmed by the reactivity of scFv G1G10 with hnRNP C immunoprecipitated from Jurkat cells using an anti-hnRNP C-specific patient serum (40). During apoptosis, hnRNP C1 and C2 are known to be cleaved, resulting in a size reduction of 2 kDa (41), which is consistent with the finding that the protein recognized by scFv G1G10 in apoptotic cell extract migrated slightly faster in SDS-PAGE than the antigen present in non-apoptotic cell extract (Fig. 4b). scFv G1G10 resulted in a nucleoplasmic staining (Fig. 4f) consistent with the localization of hnRNP C (41).
Immunoblot analysis showed that scFv R3A4 recognized a protein band of 70 kDa in non-apoptotic cell extract and a 40-kDa protein band in apoptotic cell extract (Fig. 4c) that is reminiscent of the U1-70K protein and its apoptotic cleavage product (36). The U1-70K protein is a well known autoantigen in SLE overlap syndrome, and recognition of the cleavage product by autoantisera (21) suggested that scFv R3A4, which was isolated from a patient-derived antibody library, might be targeting the U1-70K protein. A number of experiments demonstrated that this indeed was the case. First, the scFv R3A4 reacted with recombinant U1-70K (a truncation mutant consisting of the first 195 amino acids of U1-70K) in ELISA (data not shown). Second, immunofluorescence analysis, as shown in Fig. 4g, revealed that the cellular localization of the target antigen was nucleoplasmic (speckled pattern), corresponding to the localization of the U1-70K protein. Finally the sequence of scFv R3A4 cDNA appeared to be almost identical to the VH and VL sequences of scFv fragments directed to the U1-70K protein that were previously selected from SLE libraries in our laboratory (42).
Identification of an Apoptosis-dependent Epitope on the U1-70K Protein
Interestingly scFv R3A4 appeared to react more strongly with apoptotic than with non-apoptotic U1-70K on immunoblots (Fig. 4c). Similar observations were previously reported by Degen et al. (42) for other anti-U1-70K scFv fragments. We hypothesized that the efficiency by which the epitope is recognized by these scFv fragments is dependent on the apoptotic modification. To study the in vitro reactivity of anti-U1-70K antibodies with apoptotic and non-apoptotic U1-70K, anti-U1-70K antibodies (i.e. scFv R3A4, three scFv fragments previously selected from SLE libraries and designated scFv-4, -6, and -7 (42) and mouse monoclonal antibody 2.73 (43)) were used to immunoprecipitate U1 snRNP particles from apoptotic and non-apoptotic cell extracts. The U1 snRNP complex consists of the U1 snRNA molecule, three U1-specific proteins (U1A, U1C, and U1-70K), and a ring of seven distinct Sm proteins. The 40-kDa apoptotic fragment of the U1-70K protein remains associated with the U1 snRNP complex (44). The amount of immunoprecipitated U1 snRNP particles was measured by quantification of the amount of co-precipitated U1 snRNA on Northern blots. An anti-BSA scFv selected from an SLE-derived library that lacks reactivity with any of the U1 snRNP components served as a negative control. The results in Fig. 5 show that in an immunoprecipitation assay scFv fragments R3A4, scFv-4, and scFv-6 react much more strongly with apoptotic U1-70K than with non-apoptotic U1-70K, strongly suggesting that the epitope recognized by these scFv fragments is specifically present on the apoptotic fragment. scFv-7 displayed similar reactivities to the apoptotic and non-apoptotic U1-70K proteins. Mouse monoclonal antibody 2.73 reacted much more strongly with non-apoptotic U1-70K than with apoptotic U1-70K, consistent with its preferential recognition of the full-length U1-70K in immunoblotting (21).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5. U1 snRNP immunoprecipitation by anti-U1-70K scFv fragments. Several monoclonal antibodies to U1-70K were used to immunoprecipitate U1 snRNP complexes from apoptotic (a) and non-apoptotic (n) Jurkat cell extract. Apoptosis was induced by incubating the Jurkat cells with anisomycin for 8 h. Cell extracts were prepared by lysis in Nonidet P-40 lysis buffer for 30 min at 0 °C. U1 snRNP was immunoprecipitated from these extracts by anti-U1-70K scFv fragments R3A4, scFv-4, scFv-6, and scFv-7; an anti-BSA scFv; and an anti-U1-70K mouse monoclonal antibody (mAb 2.73). Co-immunoprecipitated RNA was analyzed by Northern blot hybridization with a 32P-labeled U1 snRNA-specific antisense probe. As a control RNA was also isolated directly from cell extracts. The signals on the Northern blots were quantified, and the percentage of precipitated U1 snRNA was determined.
|
|
 |
DISCUSSION
|
|---|
Here we describe a novel antibody phage display method to identify proteome-specific epitopes that are relevant for disease. Recombinant autoantibodies from patient libraries were selected on apoptotic cell extract, after subtraction on non-apoptotic cell extract, to identify disease-related targets that are specifically present in the apoptotic material. All target antigens isolated as a result of this selection strategy are proteins that are modified during apoptosis. Moreover two of the three targets are well documented autoantigens with the U1-70K protein being an important marker for SLE overlap disease. hnRNP C is autoantigenic as well, although autoantibodies to this protein have been reported in a few patients only (40, 41). So far, PSF and p54nrb have not been described as autoantigens, but one of the patients from the libraries was found to possess (low titers of) antibodies to recombinant p54nrb by immunoblotting. The autoantigenic U1-70K protein is of particular interest because it was recently demonstrated that this protein contains an apoptosis-specific B cell epitope, which is believed to be involved in breaking immunological tolerance to the U1-70K protein (20, 21, 45). We demonstrated that the anti-U1-70K scFv R3A4 reacts in vitro with an apoptosis-specific epitope on U1-70K as well. The recognition of intact U1-70K on immunoblots is believed to result from unfolding of the protein due to the electrophoresis procedure. Using large naïve libraries, the selection strategy presented here is generally applicable for the discovery of proteome-specific epitopes, as for example proteins that are exclusively present on tumor cells, or proteins that are specifically expressed during different life stages of the malaria parasite, although the selection might be more difficult when using libraries with higher complexities. The technique is especially suitable for the discovery of markers that are related to diseases in which the immune system is involved, such as autoimmune diseases. Because libraries of such patients contain high affinity antibodies, the use of these libraries will be biased toward the selection of (the most important) disease-related epitopes.
So far, selections on complex mixtures of intracellular antigens have been performed mainly using immobilization on immunotubes (13, 15) or blotting membranes (16, 18, 19). The advantage of biotinylation (in combination with magnetic streptavidin-coated beads) is that panning on antigens can be performed in solution, resulting in an optimal accessibility of the epitopes for the phages (46). The test selections, performed with anti-Ro52- and anti-La-spiked libraries, demonstrated that phages from autoimmune libraries can be selected using small amounts of biotinylated cell extracts, which would allow simultaneous competition with a large excess of the non-biotinylated normal proteome. It is possible that epitopes are changed due to the attachment of biotin groups to the protein, but this potential problem was minimized by choosing a relatively low biotin:protein ratio. Another advantage of our approach is the combinatorial approach of selection in solution and selection on two-dimensional Western blots, which decreases the amount of individual monoclonal phages to be analyzed. To our knowledge, we are the first to report such a combinatorial approach.
In the current study, phages were selected on proteins in solution during three subtractive selection rounds prior to selection on immunoblots. It is generally accepted that in such procedures diversity decreases with the progression of the selection procedure. If a higher diversity is preferred, one might continue with the phages that are selected during the first or second selection rounds. On the other hand, a less diverse phage population (such as obtained after three or more selection rounds) might give a better representation of the important targets in the antigen mixtures. Moreover after the first and second selection rounds, the concentrations of individual phages might be too low for detection of the antigens on two-dimensional immunoblots, the second selection step in the procedure described here.
Individual phages, selected on two-dimensional immunoblots, were screened on one-dimensional immunoblots to validate their reactivities. We then focused on three targets that were differentially detected in apoptotic cell extracts compared with non-apoptotic cell extracts. Obviously an automated high throughput screening system would greatly facilitate the simultaneous isolation of more possible targets. In addition by screening on immunoblots of SDS-PAGE gels, the screening was now restricted to differences between proteomes with regard to molecular weight. Combining this screening with other assays, such as immunoblots of one-dimensional isoelectric focusing gels, a capture ELISA, or a filter lift assay (47), would also augment the number of possible disease markers.
In general, the affinity of scFv fragments for antigen binding is lower compared with complete immunoglobulins, and immunoaffinity purification may therefore be less efficient. So far, a few studies have successfully used scFv fragments to isolate the unknown target antigen and to determine its identity by mass spectrometry (5, 6). We demonstrate that scFv fragments, isolated during the subtractive selection strategy presented here, can be applied successfully to immunoaffinity purify target proteins for identification by mass spectrometry. A critical parameter is the amount of cell extract needed. However, the development of more sensitive mass spectrometry equipment will allow the identification of target proteins with smaller amounts of protein and thus with less cell extract.
The postgenomic era demands innovative methods for fast target identification for a number of applications. The method described here offers an attractive platform for the discovery of potential therapeutic and diagnostic targets especially in combination with a high throughput screening system.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Prof. Winter and Dr. Nissim for the use of the synthetic library, Dr. Kristensen (Medical Research Council, Cambridge, UK) for supplying the trypsin sensitive helper phage, Dr. A. Krainer (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) for providing the p54nrb expression construct, Dr. J. Vencovsky (Charles University, Prague, Czech Republic) for supplying the anti-hnRNP C patient serum, and Dr. Y. Shav-Tal (Albert Einstein College of Medicine, Bronx, NY) for providing the anti-PSF monoclonal antibody. We thank J. den Engelsman, L. Waanders, and W. Norde for technical assistance.
 |
FOOTNOTES |
|---|
Received, July 29, 2005, and in revised form, September 22, 2005.
Published, MCP Papers in Press, October 31, 2005, DOI 10.1074/mcp.M500239-MCP200
1 The abbreviations used are: U1-70K, 70-kDa protein component of the U1 snRNP complex; DTE, dithioerythritol; hnRNP C, heterogeneous ribonucleoprotein C; HRP, horseradish peroxidase; mAb, monoclonal antibody; NBS, newborn serum; p54nrb, nuclear RNA- and DNA-binding protein of 54 kDa; PSF, polypyrimidine tract-binding protein-associated splicing factor; RA, rheumatoid arthritis; scFv, single chain Fv; SLE, systemic lupus erythematosus; snRNP, small nuclear ribonucleoprotein; SSc, systemic sclerosis; TEA, triethylamine; TMB, 3,3',5,5'-tetramethylbenzidine; VSV-G, vesicular stomatitis virus glycoprotein; cfu, colony-forming units; snRNA, small nuclear RNA 
2 J. M. H. Raats, unpublished results. 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
¶ To whom correspondence should be addressed: Dept. of Biochemistry 161, Radboud University Nijmegen, P. O. Box 9101, NL-6500 HB Nijmegen, The Netherlands. Tel.: 31-24-3614253; Fax: 31-24-3540525; E-mail: j.raats{at}ncmls.ru.nl
 |
REFERENCES
|
|---|
- Pandey, A. & Mann, M. (2000
) Proteomics to study genes and genomes.
Nature 405, 837
846[CrossRef][Medline]
- Smith, G. P. (1985
) Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface.
Science 228, 1315
1317[Abstract/Free Full Text]
- Palmer, D. B., George, A. J. & Ritter, M. A. (1997
) Selection of antibodies to cell surface determinants on mouse thymic epithelial cells using a phage display library.
Immunology 91, 473
478[CrossRef][Medline]
- Noronha, E. J., Wang, X., Desai, S. A., Kageshita, T. & Ferrone, S. (1998
) Limited diversity of human scFv fragments isolated by panning a synthetic phage-display scFv library with cultured human melanoma cells.
J. Immunol. 161, 2968
2976[Abstract/Free Full Text]
- Gao, C., Mao, S., Ronca, F., Zhuang, S., Quaranta, V., Wirsching, P. & Janda, K. D. (2003
) De novo identification of tumor-specific internalizing human antibody-receptor pairs by phage-display methods.
J. Immunol. Methods 274, 185
197[CrossRef][Medline]
- Jensen, K. B., Jensen, O. N., Ravn, P., Clark, B. F. & Kristensen, P. (2003
) Identification of keratinocyte-specific markers using phage display and mass spectrometry.
Mol. Cell. Proteomics 2, 61
69[Abstract/Free Full Text]
- van der Vuurst de Vries, A. & Logtenberg, T. (1999
) Dissecting the human peripheral B-cell compartment with phage display-derived antibodies.
Immunology 98, 55
62[CrossRef][Medline]
- Shadidi, M. & Sioud, M. (2001
) An anti-leukemic single chain Fv antibody selected from a synthetic human phage antibody library.
Biochem. Biophys. Res. Commun. 280, 548
552[CrossRef][Medline]
- Popkov, M., Rader, C. & Barbas, C. F., III (2004
) Isolation of human prostate cancer cell reactive antibodies using phage display technology.
J. Immunol. Methods 291, 137
151[CrossRef][Medline]
- Mutuberria, R., Satijn, S., Huijbers, A., Van Der Linden, E., Lichtenbeld, H., Chames, P., Arends, J. W. & Hoogenboom, H. R. (2004
) Isolation of human antibodies to tumor-associated endothelial cell markers by in vitro human endothelial cell selection with phage display libraries.
J. Immunol. Methods 287, 31
47[CrossRef][Medline]
- Tanaka, T., Ito, T., Furuta, M., Eguchi, C., Toda, H., Wakabayashi-Takai, E. & Kaneko, K. (2002
) In situ phage screening. A method for identification of subnanogram tissue components in situ.
J. Biol. Chem. 277, 30382
30387[Abstract/Free Full Text]
- Odermatt, A., Audige, A., Frick, C., Vogt, B., Frey, B. M., Frey, F. J. & Mazzucchelli, L. (2001
) Identification of receptor ligands by screening phage-display peptide libraries ex vivo on microdissected kidney tubules.
J. Am. Soc. Nephrol. 12, 308
316[Abstract/Free Full Text]
- Stausbol-Gron, B., Wind, T., Kjaer, S., Kahns, L., Hansen, N. J., Kristensen, P. & Clark, B. F. (1996
) A model phage display subtraction method with potential for analysis of differential gene expression.
FEBS Lett. 391, 71
75[CrossRef][Medline]
- Burioni, R., Plaisant, P., Bugli, F., Solforosi, L., Delli, C., V, Varaldo, P. E. & Fadda, G. (1998
) A new subtraction technique for molecular cloning of rare antiviral antibody specificities from phage display libraries.
Res. Virol. 149, 327
330[CrossRef][Medline]
- Stausbol-Gron, B., Jensen, K. B., Jensen, K. H., Jensen, M. O. & Clark, B. F. (2001
) De novo identification of cell-type specific antibody-antigen pairs by phage display subtraction. Isolation of a human single chain antibody fragment against human keratin 14.
Eur. J Biochem. 268, 3099
3107[Medline]
- Liu, B. & Marks, J. D. (2000
) Applying phage antibodies to proteomics: selecting single chain Fv antibodies to antigens blotted on nitrocellulose.
Anal. Biochem. 286, 119
128[CrossRef][Medline]
- Nakamura, M., Watanabe, H., Nishimiya, Y., Tsumoto, K., Ishimura, K. & Kumagai, I. (2001
) Panning of a phage VH library using nitrocellulose membranes: application to selection of a human VH library. J Biochem. (
Tokyo ) 129, 209
212
- Liu, B., Huang, L., Sihlbom, C., Burlingame, A. & Marks, J. D. (2002
) Towards proteome-wide production of monoclonal antibody by phage display.
J. Mol. Biol. 315, 1063
1073[CrossRef][Medline]
- Nakamura, M., Tsumoto, K., Ishimura, K. & Kumagai, I. (2002
) Phage library panning against cytosolic fraction of cells using quantitative dot blotting assay: application of selected VH to histochemistry.
J. Immunol. Methods 261, 65
72[CrossRef][Medline]
- Greidinger, E. L., Foecking, M. F., Magee, J., Wilson, L., Ranatunga, S., Ortmann, R. A. & Hoffman, R. W. (2004
) A major B cell epitope present on the apoptotic but not the intact form of the U1-70-kDa ribonucleoprotein autoantigen.
J. Immunol. 172, 709
716[Abstract/Free Full Text]
- Hof, D., Cheung, K., de Rooij, D. J., van den Hoogen, F. H., Pruijn, G. J., van Venrooij, W. J. & Raats, J. M. H. (2005
) Autoantibodies specific for apoptotic U1-70K are superior serological markers for mixed connective tissue disease.
Arthritis Res. Ther. 7, 302
309[CrossRef]
- Utz, P. J., Gensler, T. J. & Anderson, P. (2000
) Death, autoantigen modifications, and tolerance.
Arthritis Res. 2, 101
114[CrossRef][Medline]
- Hoet, R. M., Raats, J. M., de Wildt, R., Dumortier, H., Muller, S., van den Hoogen, F. & van Venrooij, W. J. (1998
) Human monoclonal autoantibody fragments from combinatorial antibody libraries directed to the U1snRNP associated U1C protein; epitope mapping, immunolocalization and V-gene usage.
Mol. Immunol. 35, 1045
1055[CrossRef][Medline]
- Raats, J. M., Roeffen, W. F., Litjens, S., Bulduk, I., Mans, G., van Venrooij, W. J. & Pruijn, G. J. (2003
) Human recombinant anti-La (SS-B) autoantibodies demonstrate the accumulation of phosphoserine-366-containing la isoforms in nucleoplasmic speckles.
Eur. J. Cell Biol. 82, 131
141[CrossRef][Medline]
- Zampieri, S., Mahler, M., Bluthner, M., Qiu, Z., Malmegrim, K., Ghirardello, A., Doria, A., van Venrooij, W. J. & Raats, J. M. (2003
) Recombinant anti-P protein autoantibodies isolated from a human autoimmune library: reactivity, specificity and epitope recognition.
Cell. Mol. Life Sci. 60, 588
598[CrossRef][Medline]
- Nissim, A., Hoogenboom, H. R., Tomlinson, I. M., Flynn, G., Midgley, C., Lane, D. & Winter, G. (1994
) Antibody fragments from a single pot phage display library as immunochemical reagents.
EMBO J. 13, 692
698[Medline]
- Kristensen, P. & Winter, G. (1998
) Proteolytic selection for protein folding using filamentous bacteriophages.
Fold. Des. 3, 321
328[CrossRef][Medline]
- Fouraux, M. A., Bouvet, P., Verkaart, S., van Venrooij, W. J. & Pruijn, G. J. (2002
) Nucleolin associates with a subset of the human Ro ribonucleoprotein complexes.
J. Mol. Biol. 320, 475
488[CrossRef][Medline]
- de Wildt, R. M., Finnern, R., Ouwehand, W. H., Griffiths, A. D., van Venrooij, W. J. & Hoet, R. M. (1996
) Characterization of human variable domain antibody fragments against the U1 RNA-associated A protein, selected from a synthetic and patient-derived combinatorial V gene library.
Eur. J. Immunol. 26, 629
639[Medline]
- Koch, C., Skjodt, K. & Laursen, I. (1985
) A simple immunoblotting method after separation of proteins in agarose gel.
J. Immunol. Methods 84, 271
278[CrossRef][Medline]
- Raats, J., van Bree, N., van Woezik, J. & Pruijn, G. (2003
) Generating recombinant anti-idiotypic antibodies for the detection of haptens in solution.
J. Immunoass. Immunochem. 24, 115
146[CrossRef][Medline]
- Raats, J. M., Wijnen, E. M., Pruijn, G. J., van den Hoogen, F. H. & van Venrooij, W. J. (2003
) Recombinant human monoclonal autoantibodies specific for citrulline-containing peptides from phage display libraries derived from patients with rheumatoid arthritis.
J. Rheumatol. 30, 1696
1711[Abstract/Free Full Text]
- Raats, J. & Hof, D. (2005
) Recombinant antibody expression vectors enabling double and triple immunostaining of tissue culture cells using monoclonal antibodies.
Eur. J. Cell Biol. 84, 517
521[CrossRef][Medline]
- Mutuberria, R., Hoogenboom, H. R., van der Linden, E., de Bruine, A. P. & Roovers, R. C. (1999
) Model systems to study the parameters determining the success of phage antibody selections on complex antigens.
J. Immunol. Methods 231, 65
81[CrossRef][Medline]
- Pruijn, G. J. M., Simons, F. H. M. & van Venrooij, W. J. (1997
) Intracellular localization and nucleocytoplasmic transport of Ro RNP components.
Eur. J. Cell Biol. 74, 123
132[Medline]
- Casciola-Rosen, L. A., Miller, D. K., Anhalt, G. J. & Rosen, A. (1994
) Specific cleavage of the 70-kDa protein component of the U1 small nuclear ribonucleoprotein is a characteristic biochemical feature of apoptotic cell death.
J. Biol. Chem. 269, 30757
30760[Abstract/Free Full Text]
- Shav-Tal, Y., Cohen, M., Lapter, S., Dye, B., Patton, J. G., Vandekerckhove, J. & Zipori, D. (2001
) Nuclear relocalization of the pre-mRNA splicing factor PSF during apoptosis involves hyperphosphorylation, masking of antigenic epitopes, and changes in protein interactions.
Mol. Biol. Cell 12, 2328
2340[Abstract/Free Full Text]
- Thiede, B., Dimmler, C., Siejak, F. & Rudel, T. (2001
) Predominant identification of RNA-binding proteins in Fas-induced apoptosis by proteome analysis.
J. Biol. Chem. 276, 26044
26050[Abstract/Free Full Text]
- Dreyfuss, G., Kim, V. N. & Kataoka, N. (2002
) Messenger-RNA-binding proteins and the messages they carry.
Nat. Rev. Mol. Cell. Biol. 3, 195
205[CrossRef][Medline]
- Stanek, D., Vencovsky, J., Kafkova, J. & Raska, I. (1997
) Heterogenous nuclear RNP C1 and C2 core proteins are targets for an autoantibody found in the serum of a patient with systemic sclerosis and psoriatic arthritis.
Arthritis Rheum. 40, 2172
2177[Medline]
- Waterhouse, N., Kumar, S., Song, Q., Strike, P., Sparrow, L., Dreyfuss, G., Alnemri, E. S., Litwack, G., Lavin, M. & Watters, D. (1996
) Heteronuclear ribonucleoproteins C1 and C2, components of the spliceosome, are specific targets of interleukin 1ß-converting enzyme-like proteases in apoptosis.
J. Biol. Chem. 271, 29335
29341[Abstract/Free Full Text]
- Degen, W. G., Pieffers, M., Welin-Henriksson, E., van den Hoogen, F. H., van Venrooij, W. J. & Raats, J. M. (2000
) Characterization of recombinant human autoantibody fragments directed toward the autoantigenic U1-70K protein.
Eur. J. Immunol. 30, 3029
3038[CrossRef][Medline]
- Billings, P. B., Allen, R. W., Jensen, F. C. & Hoch, S. O. (1982
) Anti-RNP monoclonal antibodies derived from a mouse strain with lupus-like autoimmunity.
J. Immunol. 128, 1176
1180[Abstract]
- Degen, W. G., Aarssen, Y., Pruijn, G. J., Utz, P. J. & van Venrooij, W. J. (2000
) The fate of U1 snRNP during anti-Fas induced apoptosis: specific cleavage of the U1 snRNA molecule.
Cell Death Differ. 7, 70
79[CrossRef][Medline]
- Greidinger, E. L., Foecking, M. F., Ranatunga, S. & Hoffman, R. W. (2002
) Apoptotic U1-70 kd is antigenically distinct from the intact form of the U1-70-kd molecule.
Arthritis Rheum. 46, 1264
1269[CrossRef][Medline]
- Griffiths, A. D. & Duncan, A. R. (1998
) Strategies for selection of antibodies by phage display.
Curr. Opin. Biotechnol. 9, 102
108[CrossRef][Medline]
- de Wildt, R. M., Mundy, C. R., Gorick, B. D. & Tomlinson, I. M. (2000
) Antibody arrays for high-throughput screening of antibody-antigen interactions.
Nat. Biotechnol. 18, 989
994[CrossRef][Medline]
- Shav-Tal, Y. & Zipori, D. (2002
) PSF and p54nrb/NonOmulti-functional nuclear proteins.
FEBS Lett. 531, 109
114[CrossRef][Medline]
- Zhang, Z. & Carmichael, G. G. (2001
) The fate of dsRNA in the nucleus: a p54nrb-containing complex mediates the nuclear retention of promiscuously A-to-I edited RNAs.
Cell 106, 465
475[CrossRef][Medline]
- Will, C. L. & Lührmann, R. (2001
) Spliceosomal UsnRNP biogenesis, structure and function.
Curr. Opin. Cell Biol. 13, 290
301[CrossRef][Medline]

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. Saerens, G. H. Ghassabeh, and S. Muyldermans
Antibody technology in proteomics
Brief Funct Genomic Proteomic,
July 1, 2008;
7(4):
275 - 282.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
Advertisement
Advertisement
|