Advertisement
MCP
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/mcp.M500382-MCP200 on March 24, 2006.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
M500382-MCP200v1
5/7/1193    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Glossary
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jin, J.
Right arrow Articles by Zhang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jin, J.
Right arrow Articles by Zhang, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Molecular & Cellular Proteomics 5:1193-1204, 2006.
© 2006 by The American Society for Biochemistry and Molecular Biology, Inc.


Research

Proteomic Identification of a Stress Protein, Mortalin/mthsp70/GRP75

Relevance To Parkinson Disease*,S

Jinghua Jin{ddagger}, Christine Hulette§, Yan Wang{ddagger}, Terry Zhang, Catherine Pan{ddagger}, Renu Wadhwa|| and Jing Zhang{ddagger},{ddagger}{ddagger}

From the {ddagger} Department of Pathology, University of Washington School of Medicine, Seattle, Washington 98104, § Department of Pathology, Duke University Medical Center, Durham, North Carolina 27710, Thermo Electron Corporation, San Jose, California 95134, and || Gene Function Research Center, National Institute of Advanced Industrial Science and Technology, 1-1-1 Higashi, Tsukuba Science City 305-8562, Japan


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Functional impairment of mitochondria and proteasomes and increased oxidative damage comprise the main pathological phenotypes of Parkinson disease (PD). Using an unbiased quantitative proteomic approach, we compared nigral mitochondrial proteins of PD patients with those from age-matched controls. 119 of 842 identified proteins displayed significant differences in their relative abundance (increase/decrease) between the two groups. We confirmed that one of these, mortalin (mthsp70/GRP75, a mitochondrial stress protein), is substantially decreased in PD brains as well as in a cellular model of PD. In addition, nine candidate mortalin-binding partners were identified as potential mediators of PD pathology. Manipulations of mortalin level in dopaminergic neurons resulted in significant changes in sensitivity to PD phenotypes via pathways involving mitochondrial and proteasomal function as well as oxidative stress.


Parkinson disease (PD)1 is characterized by preferential dopaminergic (DAergic) neurodegeneration in the substantia nigra pars compacta (SNpc) with subsequent DA loss in the nigrostriatal pathway and the presence of Lewy bodies in the remaining nigral neurons (1). Although the mechanisms underlying PD development remain elusive in both genetic and sporadic PD, mitochondrial and proteasomal dysfunction and oxidative stress are recognized as major contributors (2, 3). The pivotal roles of these pathways are further substantiated by the fact that all chemically induced parkinsonian models, including 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (4), rotenone (5), and more recently epoxomicin (6), lead to mitochondrial and proteasomal dysfunction as well as increased oxidative stress. Nonetheless despite decades of research, identification of molecules involved in these processes in the setting of DAergic neurodegeneration has yielded limited success. Consequently current clinical treatment of PD is at a standstill with the replacement of DA or with DAergic agonistic approaches (7, 8).

In this study, we used an unbiased state-of-the-art proteomic technique called shotgun proteomics multidimensional protein identification technology (MudPIT) to quantitatively profile mitochondrial proteins from pathologically verified PD patients and normal age-matched controls as well as in a cellular model of PD, i.e. DAergic cells treated with parkinsonian toxicant rotenone. MudPIT uses multidimensional LC and tandem mass spectrometry to separate and fragment peptides for protein identification (9) as well as for quantification when used in combination with ICAT and stable isotope labeling by amino acids in cell culture (SILAC) techniques (10, 11). With these approaches, we identified many novel proteins with quantitative expression differences in the SNpc of PD patients as compared with controls. One of these proteins, mortalin/mthsp70/GRP75, decreased significantly in many PD brain samples and in the cellular model of PD. Several mortalin-binding proteins likely participating in rotenone-mediated toxicity were also identified. Furthermore overexpression and silencing of mortalin expression in the cellular model of PD significantly influenced PD type pathologies. Thus, we report for the first time that a mitochondrial stress protein, mortalin, manipulates PD pathogenesis by its mitochondrial and proteasomal functions as well as its effect on oxidative stress.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Human Brain Samples and Immunohistochemistry
Five pathologically verified PD and five healthy control subjects were obtained from Duke University, the University of California at Los Angeles, and the University of Washington. All subjects were age-, gender-, and postmortem interval (<12 h)-matched. The Human Subjects Division from each of the universities approved this study. The neuropathological diagnosis of PD and normal controls were based on established criteria that are routinely used in our laboratory (12, 13). To perform immunohistochemistry in a separate set of control and PD patients (six PD patients and four controls, all of which were archived cases at the University of Washington), 8-µm-thick sections of nigral tissue were cut from formalin-fixed, paraffin-embedded blocks; all sections were deparaffinized with xylene followed by hydration through graded ethanol and then processed with a standard immunohistochemistry protocol (14). Sections were incubated overnight at 4 °C with mouse anti-GRP75 antibody (1:200, Stressgen Biotechnologies, Victoria, British Columbia, Canada) followed by incubation with biotin-conjugated goat anti-mouse antibody (1:200, Vector Laboratories, Burlingame, CA) for half an hour and then revealed by a standard peroxidase method with VIP chromogen (Vector Laboratories) and counterstained with hematoxylin and eosin.

Sample Preparation before Proteomics
The SNpc was dissected from controls and PD patients; an equal amount of tissue from each subject was pooled into two samples (i.e. control and PD SNpc) followed by isolation of mitochondria-enriched fractions using a method described previously (15, 16) with minor modifications. Briefly nigral tissues (~100 mg) were suspended in 1 ml of sucrose buffer containing 20 mM HEPES (pH 7.5), 320 mM sucrose, 1 mM PMSF, protease inhibitor mixture (Sigma), and phosphatase inhibitors (0.2 mM Na3VO3 and 1 mM NaF). The suspension was homogenized with 10 strokes using a glass homogenizer and then centrifuged at 4 °C at 800 x g for 10 min to sediment nuclei and unsuspended material. The supernatant was further centrifuged at 10,000 x g for 15 min to obtain the mitochondria-enriched fraction, which was resuspended in a sample buffer consisting of 6 M urea, 0.05% SDS, 5 mM EDTA, and 50 mM Tris-HCl (pH 8.5). Protein concentrations were determined by Bradford assay.

ICAT Analysis of Mitochondria-enriched Fraction with LTQ MS
A comparison of the relative abundance of protein profiles in the SNpc of control and PD patients was achieved with the ICAT labeling technique that was initially described by Gygi et al. (17) and is routinely utilized in our laboratory (11, 16, 18, 19). To perform the ICAT experiment, 100 µg of mitochondria-enriched proteins from either PD or control samples were reduced, and the cysteine groups were biotinylated with a 5-fold molar excess of either heavy (13C) (PD) or light (12C) (control) cleavable ICAT reagents. Next the two labeled samples were mixed and digested with trypsin (Promega, Madison, WI) overnight at 37 °C. Then the digested peptide solution was passed consecutively over an ionic exchange column and a monomeric avidin column (Applied Biosystem, Foster City, CA). The biotinylated peptides were eluted with 0.3% TFA in 30% acetonitrile, and biotin was cleaved from the labeled peptides with concentrated TFA. Finally the peptides were separated and analyzed on an LTQ work station (Thermo Electron Corp., San Jose, CA) using automated, on-line two-dimensional LC separation (strong cation exchange and then C18 column) followed by nanoelectrospray LC/MS (20). The eluted peptides from the strong cation exchange column (10–800 mM NH4Cl) were loaded onto one of the peptide traps, while peptides on the other trap and the PicoFrit column (5-µm BioBasic C18; 300-Å pore size; 75 µm x 10 cm; tip, 15 µm; New Objective, Woburn, MA) were eluted with a 0–65% mobile phase B gradient for 60 min and then 65–85% B for 5 min. The solvents used for the reversed-phase column were 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B) solutions. The solvent for the sample pump was 0.1% formic acid in water (C). A flow rate of 75 µl/min before the split and 250 nl/min after the split were used for the MS pump, and a flow rate of 150 µl/min before splitting and 2 µl/min after splitting were used for the sample pump. The spray voltage was 1.8 kV, the capillary temperature was 150 °C, and 35 units of collision energy were used to obtain the fragment spectra. Two MS/MS spectra of the most intense peaks were obtained following each full-scan mass spectrum. The dynamic exclusion feature was enabled to obtain MS/MS spectra on co-eluting peptides. Proteins from the mixture were later identified automatically using the computer program SequestTM, which searched the MS/MS spectra against the human International Protein Index (IPI, Version 2.33, 43,175 entries) database (11, 16, 18, 19). Search parameters for the cleavable ICAT-labeled samples used in this study were the following: +227.13 Da for static modification on cysteine residues labeled with cleavable ICAT, +9 Da for 13C isotopic ICAT-labeled cysteine, +16 Da for oxidized methionine, +57 Da for carbamidomethyl; mass tolerance, ±1.5 Da; restriction on Cys-containing peptides. Potential peptides and proteins were further analyzed with two newly developed computer software programs, PeptideProphetTM and ProteinProphetTM based on statistical models (11, 21, 22). PeptideProphet uses various Sequest scores and a number of other parameters to calculate a probability score for each identified peptide. The peptides were then assigned a protein identification using the ProteinProphet software. ProteinProphet allows filtering of large scale data sets with assessment of predictable sensitivity and false-positive identification error rates. In our study, only proteins with a high probability of accuracy (<5% error rate) were selected. Quantification of the ratio of each protein (isotopically light (control) versus heavy (PD)) was calculated using the ASAP Ratio program (23). The algorithm utilized for calculation of ASAP Ratios of signals recorded for the different isotopic forms of peptides of identical sequence are based on numerical and statistical methods, such as Savitzky-Golay smoothing filters, statistics for weighted samples, and Dixon’s test for outliers, to evaluate protein abundance ratios and their associated errors. Information about these software tools and the software tools themselves can be found on line at www.systemsbiology.org/Default.aspx?pagename_proteomicssoftware and downloaded freely.

It should be emphasized that ICAT analysis was performed with pooled samples based on the following rationales. The sampling reproducibility is about 30 and 60% for LCQ and LTQ instruments, respectively. This is largely due to the fact that LCQ or LTQ (one of the best ESI type MS systems available today) only captures a small fraction of the peptides detected by the first stage of MS analysis. Thus, it is expected that multiple runs with pooled samples can increase proteome coverage while decreasing interindividual variability. It cannot be stressed enough, however, that despite the fact that the protein profile in each ICAT experiment may vary when complex protein mixtures are analyzed multiple times due to reasons mentioned above, quantitative information is valid when the same peptide is detected simultaneously in paired samples (11, 16). This is because MS looks for the corresponding peptide (e.g. light if heavy is captured) and does so with very high sensitivity.

Cellular Model of PD
The DAergic neurons used in this study are MES cells, which express most features of human DAergic neurons and have been widely used in PD-related experiments (2426). Detailed methods for culturing MES cells have been previously described by us (26). Cells were seeded overnight and then treated with 2.5–10 nM rotenone (a potent inhibitor of mitochondrial complex I) or vehicle (0.1% DMSO) for 3 days.

SILAC Analysis of Proteins Associated with Mortalin
MES cells were grown in culture medium containing 12C-Arg or [13C]Arg, respectively, for at least 3 days followed by treatment with 5 nM rotenone (prelabeled with [13C]Arg) or DMSO (prelabeled with [12C]Arg) for 3 days. The cells were counted and lysed in ice-cold Nonidet P-40 lysis buffer (150 mM NaCl, 0.5% Nonidet P-40, 50 mM Tris, pH 8.0) containing a mixture of protease and phosphatase inhibitors. Lysates were then centrifuged for 10 min at 14,000 x g and 4 °C; the supernatants were precleared with Protein A/G-agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA), and then protein concentrations were measured by standard BCA assay. Equal amounts of the protein from rotenone- and DMSO-treated cells were pooled together and incubated overnight with mortalin (GRP75) antibody followed by incubation with protein A/G-agarose beads. The pulldown proteins were eluted in buffer containing 6 M urea, 0.05% SDS, 5 mM EDTA, and 50 mM Tris-HCl (pH 8.5) and then digested with trypsin as described previously (27). The digests were analyzed by MS with methods described above.

Gene Manipulation in MES Cells
Transfection of Mortalin-2 (GRP75) in MES Cells and Selection by Flow Cytometry—
GFP-tagged mortalin was expressed from pEGFP-C1/mot-2. Cells were transfected with pEGFP-C1/mot-2 or pEGFP-C1 as described previously (28) and according to the manufacturer’s specifications (FuGENE 6, Roche Applied Science). Clones with high mortalin-2 expression levels were selected by flow cytometry using GFP and replated to form stable cell lines. Mortalin-2 expression levels were assessed by Western blot.

Mortalin siRNA Transfection in MES Cells—
MES cells plated in 24-well culture dishes were transfected with 5 nM mouse mortalin-specific siRNA (Mm_Hspa9a_1 HP siRNA (Qiagen, Valencia, CA); the target sequence is CACGTTTCTGCCAAAGATAAA, located in the middle of the gene (GenBankTM accession number NM_010481)) constructs or nonspecific control siRNA constructs (Qiagen) using HiPerFect transfection reagent (Qiagen). Twenty-four hours after siRNA transfection, cells were treated with vehicle or 2.5–10 nM rotenone for 3 days. Neurotoxicity was measured by trypan blue exclusion assay, and then the harvested cells were used for Western blot analysis for assessment of mortalin level.

Cell Viability and Functional Analysis
Viability—
Untransfected cells and cells transfected with vector or mortalin-2 were seeded in 24-well plates at 25,000 cells/well and treated with vehicle or rotenone at 2.5, 5, and 10 nM, respectively, for 3 days. The cells were collected and mixed with trypan blue dye solution before being counted with a hemacytometer.

Measurement of Mitochondrial Complex I Activity—
Mitochondria were isolated and assayed for complex I activity using methods described previously (29). Briefly complex I (NADH-ubiquinone oxidoreductase) activity was measured by monitoring the loss of absorbance at 340 nm ({epsilon} = 6.81 mM–1·cm–1) resulting from the oxidation of n-decylubiquinone (130 µM) at 30 °C.

Measurement of Proteasomal Activity—
20 S chymotrypsin-like and postglutamyl peptidase proteasomal activities were determined as described previously by measuring the fluorescence of 7-amido-4-methylcoumarin liberated from peptide-7-amido-4-methylcoumarin-linked substrates (30). The results, expressed as fluorescence units/min/mg of protein, were normalized against inhibition of total proteasomal function by 10 µM lactacystin.

Protein Carbonyl Assay for Oxidative Stress—
Protein oxidation was measured by quantifying total protein carbonyl contents using 2,4-dinitrophenylhydrazine (DNPH). The spectrum difference between DNPH-treated and control samples was determined, and results were expressed as nanomoles of DNPH incorporated/mg of protein based on the absorption at 375 nm ({epsilon} = 21.0 mM–1·cm–1). Protein concentration was determined by standard BCA assay.

Immunofluorescent Staining of Transfected MES Cells and Confocal Microscopy Analysis
MES cells transfected with GFP or GFP-mortalin were seeded on chambered glass slides (Nalge Nunc, Naperville, IL) and then fixed in 4% paraformaldehyde followed by overnight incubation with primary antibody cytochrome c (1:200, BD Pharmingen) and then incubation with secondary antibody (1:200 Flex Fluor® 568 goat anti-mouse IgG, Molecular Probes, Eugene, OR). A laser scanning confocal microscope (Bio-Rad LS2000) was used to capture images.

Western Blot
10 µg of protein from mitochondria-enriched fractions as well as the cytosol-enriched fractions from human SNpc or MES cells, were subjected to 8–16% SDS-PAGE and transferred to PVDF, blocked, and probed overnight at 4 °C with mouse anti-GRP75 antibody (1:20,000, Stressgen Biotechnologies); peroxidase-conjugated secondary antibody was added at 1:20,000 and developed with enhanced chemiluminescence.

Statistical Methods
Grouped data are expressed as mean ± S.E. Changes between groups were analyzed by one-way analysis of variance or Student’s t test using GraphPad Prism 3.0 (San Diego, CA). All measurements were repeated at least three times in all experiments. p < 0.05 was accepted as significant.


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Quantitative Analysis of Protein Profiles in the Mitochondria-enriched Fractions—
Mitochondria-enriched fractions were pooled from the SNpc of five PD patients and age-matched controls, respectively, using our recently described methods (16). Next three independent ICAT analyses were performed in pooled samples with the identification results of each of the three independent runs combined, yielding identification of a grand total of 842 proteins. Proteins identified with ≥2 peptides and a single peptide are listed in Supplemental Appendix I (a total of 653 proteins/groups) and Supplemental Appendix II (a total of 189 proteins/groups), respectively. The rationales for pooling samples and combining results from all runs are discussed briefly under "Experimental Procedures" but in greater detail in our previous publications (10, 11, 16, 18, 19). As expected, the majority of proteins listed in Supplemental Appendices I and II with known functions are related to mitochondria with a significant portion of them (~40%) being linked to either signal transduction, the ubiquitin proteasomal system, or regulation of oxidative stress, all of which have been implicated in PD pathogenesis (3133).

Table I lists the 119 proteins that displayed significant changes in relative abundance between PD and controls in at least two independent experiments; these proteins are more likely to play major roles in PD development or progression. For example, a subunit of NADH-ubiquinone oxidoreductase (part of mitochondrial complex I) was significantly decreased in PD compared with controls; this is consistent with earlier observations showing decreased mitochondrial complex I activity in PD patients (3437). To catalog our data for further analysis, we have separated the proteins into four groups in alphabetical order within each category (Table I): proteins whose levels 1) increased ≥2-fold (ASAP Ratio ≤ 0.5), 2) increased between 1.25- and 2-fold (0.5 < ASAP Ratio ≤ 0.75), 3) decreased ≥2-fold (ASAP Ratio ≥ 2), and 4) decreased between 1.25- and 2-fold (1.25 ≤ ASAP Ratio < 2) when 100 µg of protein from PD was paired with 100 µg from control.


View this table:
[in this window]
[in a new window]
 
TABLE I Relative abundance of proteins between PD and controls

The results are expressed as 12C (control)/13C (PD). Proteins sharing the same peptides but with different protein identification numbers are listed in one cell.

 
Validation of Mortalin with Western Blot Analysis in PD Patients—
The current protein database is incomplete; hence proteins inferred from peptide sequence could be wrong. Consequently candidate proteins identified by proteomics need to be validated before their biological roles are pursued extensively. In our first step toward verifying proteins most likely to have biological importance, we chose mortalin (also referred to as stress-70 protein, mitochondrial precursor (mthsp70), PBP74, or GRP75), whose relative level in mitochondria-enriched fractions decreased significantly in PD compared with controls. Biological testing of this molecule in other systems indicates its critical role in cell proliferation and survival (38). As shown in Fig. 1A, the expression of mortalin was not only detected by an alternative method, Western blot analysis, in both cytosol- and mitochondria-enriched fractions but also appeared to be less abundant in mitochondria-enriched fractions of PD samples compared with controls. Semiquantitative analysis of bands indicated that the mortalin level was decreased by about 2-fold in PD, consistent with our proteomic analysis findings.


Figure 1
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1. Analysis of mortalin expression in human brain. A, relative abundance of mortalin in the mitochondria (mt)- and cytosol (cyt)-enriched fractions of control (Con) and PD using pooled samples was analyzed with Western blot assay. Each lane contained 10 µg of protein. B, distribution of mortalin in midbrain including substantia nigra pars compact. Expression of mortalin (purple granular staining) was present in both non-pigmented (not shown) and pigmented, i.e. DAergic, neurons in the SNpc, whereas glial staining is minimal throughout the midbrain. Notably the intensity of mortalin staining appeared to be stronger in controls (left panel) than in PD (right panel). However, mortalin did not co-localize with Lewy bodies (right panel, inset). These observations were largely true for all 10 cases studied (n = 6 for PD and n = 4 for controls, respectively). Arrowheads indicate positive stained pigmented neurons; arrows indicate Lewy bodies in the pigmented DAergic neuron. Dark granules are neuromelanin. C, mortalin expression level was also evaluated in the mitochondria (mt)- and cytosol (cyt)-enriched fractions of individual cases (in C, n = 5 for both groups). Each lane contained 10 µg of protein. D, the expression level of mortalin obtained in C was calculated by determining the total relative OD for each fraction (representing equal starting material), demonstrating that mortalin preferentially decreased in the mitochondrial fraction in PD patients compared with controls (*, p < 0.05).

 
To test whether mortalin was actually expressed in the remaining DAergic neurons in PD patients, immunohistochemical studies with mortalin antibody were carried out in a separate set of PD patients (n = 6) and controls (n = 4). Results demonstrated that, although glial staining was minimal, mortalin expression was readily visible in both DAergic and non-DAergic neurons (not shown). Furthermore it appeared that the expression level in controls (Fig. 1B, left panel) was stronger than in PD patients (Fig. 1B, right panel), i.e. consistent with proteomic analysis. Finally mortalin staining was absent in Lewy bodies (Fig. 1B, right panel, inset).

Both proteomic and Western blot analyses were done with pooled samples; this approach, although advantageous in many aspects, cannot determine whether the decrease in mortalin resulted from a large decrease in a single patient or from smaller decreases in multiple patients. Furthermore although immunohistochemical studies were performed in individual cases, it is not a reliable technique for demonstrating decreased mortalin expression in DAergic neurons of PD patients compared with controls (Fig. 1B). To address these issues, Western blot analyses were conducted in individual cases from which the samples were pooled. Fig. 1, C and D, show that mortalin expression decreased in the majority of mitochondria-enriched fractions from the PD cases (p < 0.05), whereas there was no significant change in cytosol-enriched fractions.

Investigation of Mortalin in a Cellular Model of PD—
Rotenone, a potent mitochondrial inhibitor, produces selective DAergic neurodegeneration with formation of Lewy body-like inclusions in the remaining DAergic neurons in rodents (5, 39). We as well as others have demonstrated in a cellular model of PD that rotenone-mediated neurotoxicity is largely associated with increased oxidative stress and/or proteasomal dysfunction (5, 40). Thus, we next investigated whether a decrease in mortalin level is upheld in the cellular model of PD. As can be seen in Fig. 2A, consistent with our previous results (11), rotenone exposure at 2.5–10 nM produced a dose-dependant neurotoxicity 3 days after treatment. More importantly, although rotenone exposure had no significant effect on mortalin level when total lysate was analyzed, mortalin level was reduced in the mitochondria-enriched fractions (Fig. 2B), consistent with the results obtained in human SNpc as shown in Fig. 1.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 2. Cell viability assay and mortalin expression in MES cells treated with rotenone. A, rotenone-induced neurotoxicity in MES cells. Cells were seeded in 100-mm dishes at 3.08E4 cells/cm2 and treated with vehicle or 2.5–10 nM rotenone for 3 days. Rotenone-induced toxicity was assessed using trypan blue exclusion assay and expressed as percentage of vehicle-treated controls. B, Western blot analysis of mortalin in MES cells treated with rotenone. MES cells were fractionated into cytosol (cyt)- and mitochondria (mt)-enriched fractions after treatment with DMSO or rotenone at 5 nM for 3 days. Relative expression levels of mortalin were determined by calculating the total OD for each fraction (representing equal starting material). Although the overall mortalin level was not different between rotenone- versus DMSO-treated cells, its level was preferentially decreased in the mitochondria-enriched fraction in PD compared with controls (*, p < 0.05).

 
Given that the mortalin level decreased preferentially in the mitochondria in both PD and a cellular model of PD, we used a novel proteomic technique (SILAC) (41), which was recently established in our laboratory (10), to investigate proteins associated with mortalin with an emphasis on mitochondria-related proteins. The major advantage of this technique, which is only applicable to cells in culture, is that it labels cells before experiments start, thereby removing most false positives due to processing inconsistency or variations in labeling efficiency that could occur in ICAT assays. In this study, prelabeled MES cells ([12C]Arg versus [13C]Arg) were treated with vehicle or rotenone at 5 nM for 3 days, and then an equal amount of proteins were combined from control and treated cell lysates before mortalin and associated proteins were immunoprecipitated and identified by MS. This analysis revealed over 100 proteins; those clearly related to mitochondria, a total of nine proteins, are listed in Table II.


View this table:
[in this window]
[in a new window]
 
TABLE II Mortalin-associated proteins

Not all mortalin-associated proteins were identified in human tissue analysis (Supplemental Appendices I and II), and one of the major reasons could be variation in MS sampling. {Downarrow}, decreased more than 2-fold; {downarrow}, decreased between 1.25- and 2-fold; {Uparrow}, increased more than 2-fold.

 
Among the mortalin-associated proteins that are related to mitochondria, some, e.g. thymidine kinase 2 (mitochondrial precursor), were regulated by rotenone, whereas others, e.g. hsp60, were not. Although changes in the relative abundance of the mortalin-associated protein complex after rotenone treatment (samples prepared via immunoprecipitation) cannot be directly compared with those in the human tissue analysis (samples prepared via fractionation), several similarities and differences were observed between these two analyses. For instance, although acyl-CoA dehydrogenase (short/branched chain-specific) showed no change in either human or cellular PD models, the relative abundance of hsp60 was increased by more than 100% in human PD samples (Table I), yet its relative abundance did not change in the mortalin-associated protein complex after rotenone exposure.

Effects of Manipulating Mortalin Expression on Rotenone-induced Neurotoxicity—
Investigation of mortalin in human PD and a cellular model of PD have clearly indicated that mortalin and/or its associated proteins are likely to play major roles in PD pathogenesis. Thus, we went on to ask whether the loss of mortalin was contributing to toxicity and whether its replacement would offset such toxicity. Fig. 3A, left panel, shows that transfection of the mortalin gene increased mortalin expression to 200% of controls transfected with empty vector. To study the cellular distribution of overexpressed mortalin, we analyzed GFP-tagged mortalin in both fractionated cells and its relation to the mitochondrial protein cytochrome c. It is clear that not only did mortalin transfection increase cellular mortalin, but the mortalin level was also increased preferentially in the mitochondrial fraction (Fig. 3B). Semiquantitative analysis indicated that the mortalin level after gene transfection was 2- and 1.5-fold of vector-transfected cells in the mitochondria- and cytosol-enriched fractions, respectively. In addition, the majority of GFP-tagged mortalin was co-localized with cytochrome c in the mitochondria, whereas control GFP was distributed throughout the cells (Fig. 3C), further confirming that overexpressed mortalin was indeed transported into the mitochondria. When cell viability was measured (Fig. 3D), mortalin overexpression had no effect on cell viability in vehicle-treated cells (Fig. 3D, left panel) but substantially enhanced rather than attenuated rotenone-mediated neurotoxicity (Fig. 3D, right panel), suggesting that rotenone toxicity may be mediated in part via mortalin or its associated proteins with the eventual outcome being reduced mitochondrial mortalin level.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 3. Effects of manipulating the mortalin gene in DAergic neurons. A, mortalin expression level in MES cells transfected with expression vector or siRNA. MES cells were transfected with empty plasmid versus plasmid containing GFP-mortalin (left panel) or nonspecific (NC)-siRNA versus mot-2-siRNA (right panel), respectively. Cells were lysed at 48 h after transfection, and expression levels of mortalin were analyzed by Western blot. Each lane contained 10 µg of protein. Molecular masses of mortalin and GFP-mortalin are 74 and 100 kDa, respectively. B, Western blot analysis of mortalin in mitochondria- and cytosol-enriched fractions. Cells transfected with vector (GFP) or mortalin (Mot-2) were lysed and fractionated into cytosol (cyt)- and mitochondria (mt)-enriched fractions. The mortalin expression level was analyzed by Western blot. Each lane contained 10 µg of protein. C, co-localization of GFP-mortalin and cytochrome c in mitochondria. Cells transfected with vector (Row 1, labeled as MES-pEGFP) or mortalin (Row 2, labeled as MES-pmot-2) were fixed in 4% paraformaldehyde followed by overnight incubation with primary antibody cytochrome c and then incubation with Flex Fluor 568 goat anti-mouse secondary antibody. A laser scanning confocal microscope was used to capture images, demonstrating that most of the mortalin (green color in Column 1) was co-localized with cytochrome c (red color in Column 2), i.e. shown in Column 3 as yellow color after merging green and red channels. D, increasing and decreasing mortalin expression had no effect on viability in control cells but significantly influenced rotenone-induced neurotoxicity. Untransfected cells or cells transfected with expression vector or siRNA were seeded in 100-mm dishes at 3.08E4 cells/cm2 and treated with vehicle or 5 nM rotenone for 3 days. Rotenone-induced toxicity was assessed using trypan blue exclusion assay and expressed as percentage of controls. *, p < 0.05 for cells transfected with mortalin or mot-2-siRNA compared with vehicle transfection; **, p < 0.01 for cells transfected with mortalin or mot-2-siRNA compared with vehicle transfection.

 
Next we tested the effects of silencing mortalin. As demonstrated in Fig. 3A, right panel, mortalin level decreased to less than 10% of controls 2 days after gene silencing was initiated. Similar to the results obtained in the overexpression study, reducing mortalin level was nontoxic to MES cells treated with vehicles (Fig. 3D, left panel). Consistent with our results seen with overexpression, decreasing native mortalin protein level protected MES cells from rotenone-mediated neurotoxicity (Fig. 3D, right panel), strongly suggesting mortalin is an essential component of the rotenone effect.

Effects of Mortalin Transfection on Mitochondrial Complex I Activity, Oxidative Stress, and Proteasomal Function—
Although the above experiments argue solidly that mortalin is a major target of rotenone, the mechanisms involved are largely unknown. It is well known that rotenone is a potent inhibitor of mitochondrial complex I that in turn produces significant oxidative stress and inhibits proteasomal function in MES cells (5, 42). To further determine the role(s) of mortalin in the rotenone effect, we compared the effects of rotenone on mitochondrial complex I and proteasomal function as well as oxidative stress in cells with or without overexpression of mortalin. Similar to our observation that overexpression of mortalin was nontoxic in the absence of rotenone (see Fig. 3D), we found no difference in these endpoints between untreated cells with and without overexpressed mortalin. However, in the presence of rotenone, we observed marked differences. Consistent with the observations of others (5, 42) as well as our own (11), 5 nM rotenone treatment of untransfected and vector-transfected cells for 3 days significantly suppressed mitochondrial complex I activity, increased oxidative stress, and induced inhibition of both chymotrypsin-like and glutamyl peptidase activities. Also consistent with the observation of neurotoxicity shown in Fig. 3D, mortalin transfection significantly enhanced mitochondrial inhibition, oxidative stress, and proteasomal dysfunction induced by rotenone (Fig. 4).


Figure 4
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. Mortalin transfection enhanced rotenone-induced oxidative stress as well as mitochondrial and proteasomal inhibition. Untransfected cells or cells transfected with vector or mortalin were seeded in 100-mm dishes at 3.08E4 cells/cm2 and treated with vehicle or 5 nM rotenone for 3 days. Rotenone-induced toxicity was assessed using mitochondrial complex I activity (A), extent of oxidative stress, i.e. protein oxidation as indicated by carbonyl levels (B), and proteasomal activities (C). Results are expressed as percentage of DMSO-treated controls and are the mean ± S.E. from at least four independent experiments in triplicate. **, p < 0.01 compared with both untransfected and vector-transfected cells treated with rotenone; *, p < 0.05 compared with both untransfected and vector-transfected cells treated with rotenone. Notably no difference was seen in vehicle-treated MES cells from those transfected with empty vector or mortalin gene and treated with vehicle (data not shown).

 

    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Our current study yielded several major findings. First, 842 proteins were identified in the mitochondria-enriched fractions isolated from human SNpc; of these, 119 proteins displayed significant differences in their relative abundance between PD patients and controls. One of the validated proteins, mortalin, although not associated with Lewy bodies, was expressed in DAergic neurons. Second, as in human PD, mortalin also preferentially decreased in the mitochondrial fraction of DAergic cells treated with rotenone, and a few candidate proteins likely participating in rotenone-mediated toxicity were identified. Third, overexpression and silencing of mortalin in DAergic cells significantly influenced cell viability only when cells were treated with rotenone, suggesting that mortalin is one of the major targets of rotenone. Finally mortalin influenced rotenone-mediated toxicity via pathways involving oxidative stress and mitochondrial and proteasomal dysfunction.

A total of 842 proteins were identified and quantified with a robust proteomic technique in the mitochondria-enriched fractions isolated from human SNpc; however, some mitochondrial proteins reported in the literature were not observed in our study. Besides the limitation of MS, a few other potential explanations can account for this discrepancy, including the following. 1) Some mitochondrial proteins do not contain cysteine residues (e.g. cytochrome oxidase polypeptide Vic) and thus are transparent to the ICAT method, and 2) several reported mitochondrial proteins such as mitochondrial import inner membrane translocase subunit TIM8 B, were identified in our study by one peptide but failed to meet our criteria or those of most investigators in proteomic research (43). Finally it should be noted that a few cytoplasmic proteins are also listed in Supplemental Appendices I and II; this should not be surprising as the samples used were mitochondria-enriched fractions, not purified mitochondria, and thus contained a few other membranous elements.

ICAT quantification of the mitochondria-enriched fractions of SNpc identified numerous proteins with significant quantitative differences between PD and controls. In particular, numerous subunits of the mitochondrial complexes were substantially decreased in PD patients, including those associated with complex I (e.g. NADH-ubiquinone 42-kDa B14.7 subunit) as well as other mitochondrial complexes including cytochrome c oxidase (complex III) polypeptide I. These observations are noteworthy as they provide protein substrates for mitochondrial dysfunction in PD pathogenesis (16). Nonetheless despite the fact that all proteins with quantitative differences between two groups may have a potential role in PD pathogenesis, all of them need to be validated not only for identification but also quantification (as we did for mortalin) before their functional roles are pursued extensively. This is because proteins could be misidentified by proteomics due to the incompleteness of the current database.

SILAC analysis of mortalin-associated proteins after rotenone exposure revealed many proteins, some of which are clearly related to mitochondrial function. It is obvious that proteins whose levels are modulated by rotenone, e.g. acyl-CoA dehydrogenase family member 9 and phosphate carrier protein (Table II), are worth further pursuit because they are likely to be key players in mediating the effects of mortalin on rotenone-induced neurotoxicity. On the other hand, despite the fact that rotenone did not change the level of hsp60 in mortalin-associated protein complex, it is still possible that the function of hsp60 could be altered if the nature of mortalin changes (see "Discussion" below). It should be noted here that hsp60 has already been validated recently by one of our co-authors to interact with mortalin both in vivo and in vitro in a different experimental system (44).

In the current study, we validated that the mortalin level was not only decreased in the mitochondrial fraction of PD patients but also in a cellular model of PD. Previous studies, largely focused on cancer biology, have suggested a role of mortalin as an antiapoptosis protein because 1) overexpression of mortalin resulted in malignant transformation of NIH 3T3 (45) and lifespan extension of normal human fibroblasts (46), 2) expression levels of mortalin were elevated in human brain tumors (47), and 3) reduction in the mortalin level by its antisense expression caused senescence-like growth arrest in immortalized human cells (48). The function(s) of mortalin in DAergic cells, or more specifically in the mitochondria of these cells, is unknown. Neither overexpression nor silencing of mortalin level had any significant effects on the viability of MES cells treated with vehicle, suggesting that decreasing mortalin level alone is probably insufficient in causing neurodegeneration. In fact, a decrease in mortalin level has also been observed in aging kidneys (49). Nonetheless overexpression of mortalin rendered DAergic cells more vulnerable to rotenone-induced neurotoxicity, whereas down-regulated mortalin expression produced opposite effects, arguing strongly that mortalin is a critical player in rotenone-mediated neurotoxicity. We ruled out the possibility that increased neurotoxicity was due to the inability of overexpressed mortalin to enter the mitochondria, thereby disrupting normal cytosolic protein functions (Fig. 3). We also confirmed that the mechanisms by which mortalin mediates rotenone associated toxicity involved enhanced oxidative stress as well as mitochondrial and proteasomal dysfunction (Fig. 4), all of which have been implicated in PD pathogenesis. The question that remains to be answered is how precisely does mortalin execute its effect on rotenone-mediated neurotoxicity? Rotenone exposure reduced the mitochondrial mortalin level, but silencing native mortalin offset rotenone-mediated toxicity, suggesting that it is the delicate balance of mortalin and its associated proteins (not necessarily the absolute level of mortalin) that determines the sensitivity of DAergic cells to rotenone. To this end, we have already identified several mortalin-binding proteins, and their biological functions in rotenone-mediated toxicity will be investigated further. Finally mortalin appears to be oxidized in an animal model of Alzheimer disease (50), raising the possibility that changes in mortalin structure may also be important in neurodegenerative diseases. It is feasible that increased oxidative stress due to rotenone exposure oxidizes mortalin, particularly when it is overexpressed, thereby influencing the functions of mortalin and/or its associated proteins, e.g. hsp60, and ultimately affecting rotenone-induced neurotoxicity. However, it should be noted that we have not examined the nature and/or extent of post-translational modification of mortalin, including whether it is oxidized when exposed to rotenone, in our studies. Post-translational modification of mortalin, if present in this model, can be as important as the change in its relative abundance in terms of modulating rotenone-mediated neurotoxicity or even human PD.

In summary, with pathologically verified human tissues we identified numerous novel proteins that likely contribute to PD pathogenesis. We validated one of these proteins, mortalin, in both human samples and a cellular model of PD and demonstrated that it was preferentially decreased in mitochondrial fractions. Furthermore overexpression and silencing of mortalin level in DAergic cells significantly influenced cell viability when treated with rotenone, suggesting that mortalin is a major mediator of neurotoxicity induced by this widely used parkinsonian toxicant. Finally although detailed mechanisms underlying the interactions between mortalin and its associated proteins remain to be characterized, the effects of mortalin on rotenone-mediated toxicity appeared to involve oxidative stress as well as mitochondrial and proteasomal dysfunction.


    ACKNOWLEDGMENTS
 
We thank Dr. Kathy Montine, David Zhu, and Leo Chen for assistance during manuscript preparation.


   FOOTNOTES
 
Received, November 18, 2005

Published, March 1, 2006

Published, MCP Papers in Press, March 24, 2006, DOI 10.1074/mcp.M500382-MCP200

1 The abbreviations used are: PD, Parkinson disease; ASAP, automated statistical analysis of protein abundance; DA, dopamine; DAergic, dopaminergic; DNPH, 2,4-dinitrophenylhydrazine; IPI, International Protein Index; MudPIT, multidimensional protein identification technology; SILAC, stable isotope labeling by amino acids in cell culture; SNpc, substantia nigra pars compacta; GFP, green fluorescent protein; siRNA, small interfering RNA; MES, rat mesencephalic neuronal cell line. Back

* This work was supported by the National Institutes of Health Grants ES012703 and AG025327 (to J. Z.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

S The on-line version of this article (available at http://www.mcponline.org) contains supplemental material. Back

{ddagger}{ddagger} To whom correspondence should be addressed: Division of Neuropathology, University of Washington School of Medicine, Box 359635 Harborview Medical Center, Seattle, WA 98104. Tel.: 206-341-5245; Fax: 206-341-5249; E-mail: zhangj{at}u.washington.edu


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lowe, J. S., and Leigh, N. (2002) in Greenfield’s Neuropathology (Graham, D. I., and Lantos, P. L., eds) pp. 325 –430, Arnold, London

  2. McNaught, K. S., Olanow, C. W., Halliwell, B., Isacson, O., and Jenner, P. (2001) Failure of the ubiquitin-proteasome system in Parkinson’s disease. Nat. Rev. Neurosci. 2, 589 –594[CrossRef][Medline]

  3. Owen, A. D., Schapira, A. H., Jenner, P., and Marsden, C. D. (1996) Oxidative stress and Parkinson’s disease. Ann. N. Y. Acad. Sci. 786, 217 –223[Medline]

  4. Langston, J. W., Ballard, P., Tetrud, J. W., and Irwin, I. (1983) Chronic Parkinsonism in humans due to a product of meperidine-analog synthesis. Science 219, 979 –980[Abstract/Free Full Text]

  5. Betarbet, R., Sherer, T. B., MacKenzie, G., Garcia-Osuna, M., Panov, A. V., and Greenamyre, J. T. (2000) Chronic systemic pesticide exposure reproduces features of Parkinson’s disease. Nat. Neurosci. 3, 1301 –1306[CrossRef][Medline]

  6. McNaught, K. S., Perl, D. P., Brownell, A. L., and Olanow, C. W. (2004) Systemic exposure to proteasome inhibitors causes a progressive model of Parkinson’s disease. Ann. Neurol. 56, 149 –162[CrossRef][Medline]

  7. Kim, D. W. (2004) Efficient induction of dopaminergic neurons from embryonic stem cells for application to Parkinson’s disease. Yonsei Med. J 45, (suppl.) 23 –27[Medline]

  8. Ogawa, N. (1998) Early introduction of dopamine agonists in the long-term treatment of Parkinson’s disease. Neurology 51, S 13 –20

  9. Link, A. J., Eng, J., Schieltz, D. M., Carmack, E., Mize, G. J., Morris, D. R., Garvik, B. M., and Yates, J. R., III (1999) Direct analysis of protein complexes using mass spectrometry. Nat. Biotechnol. 17, 676 –682[CrossRef][Medline]

  10. Zhou, Y., Wang, Y., Kovacs, M. I., Jin, J., and Zhang, J. (2005) Microglial activation induced by neurodegeneration. A proteomic analysis. Mol. Cell. Proteomics 4, 1471 –1479[Abstract/Free Full Text]

  11. Zhou, Y., Gu, G., Goodlett, D. R., Zhang, T., Pan, C., Montine, T. J., Montine, K. S., Aebersold, R. H., and Zhang, J. (2004) Analysis of {alpha}-synuclein-associated proteins by quantitative proteomics. J. Biol. Chem. 279, 39155 –39164[Abstract/Free Full Text]

  12. Michotte, A. (2003) Recent developments in the neuropathological diagnosis of Parkinson’s disease and parkinsonism. Acta Neurol. Belg. 103, 155 –158[Medline]

  13. Zhang, J., Montine, T. J., Smith, M. A., Siedlak, S. L., Gu, G., Robertson, D., and Perry, G. (2002) The mitochondrial common deletion in Parkinson’s disease and related movement disorders. Parkinsonism Relat. Disord. 8, 165 –170[Medline]

  14. Zhang, J., Perry, G., Smith, M. A., Robertson, D., Olson, S. J., Graham, D. G., and Montine, T. J. (1999) Parkinson’s disease is associated with oxidative damage to cytoplasmic DNA and RNA in substantia nigra neurons. Am. J. Pathol. 154, 1423 –1429[Abstract/Free Full Text]

  15. Krapfenbauer, K., Fountoulakis, M., and Lubec, G. (2003) A rat brain protein expression map including cytosolic and enriched mitochondrial and microsomal fractions. Electrophoresis 24, 1847 –1870[CrossRef][Medline]

  16. Jin, J., Meredith, G. E., Chen, L., Zhou, Y., Xu, J., Shie, F. S., Lockhart, P., and Zhang, J. (2005) Quantitative proteomic analysis of mitochondrial proteins: relevance to Lewy body formation and Parkinson’s disease. Brain Res. Mol. Brain Res. 134, 119 –138[Medline]

  17. Gygi, S. P., Rist, B., Gerber, S. A., Turecek, F., Gelb, M. H., and Aebersold, R. (1999) Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat. Biotechnol. 17, 994 –999[CrossRef][Medline]

  18. Zhang, J., Goodlett, D. R., Peskind, E. R., Quinn, J. F., Zhou, Y., Wang, Q., Pan, C., Yi, E., Eng, J., Aebersold, R. H., and Montine, T. J. (2005) Quantitative proteomic analysis of age-related changes in human cerebrospinal fluid. Neurobiol. Aging 26, 207 –227[CrossRef][Medline]

  19. Zhang, J., Goodlett, D. R., Quinn, J. F., Peskind, E., Kaye, J. A., Zhou, Y., Pan, C., Yi, E., Eng, J., Wang, Q., Aebersold, R. H., and Montine, T. J. (2005) Quantitative proteomics of cerebrospinal fluid from patients with Alzheimer disease. J. Alzheimer’s Dis. 7, 125 –133[Medline]

  20. Chelius, D., Zhang, T., Wang, G., and Shen, R. F. (2003) Global protein identification and quantification technology using two-dimensional liquid chromatography nanospray mass spectrometry. Anal. Chem. 75, 6658 –6665[Medline]

  21. Keller, A., Nesvizhskii, A. I., Kolker, E., and Aebersold, R. (2002) Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal. Chem. 74, 5383 –5392[Medline]

  22. Keller, A., Purvine, S., Nesvizhskii, A. I., Stolyar, S., Goodlett, D. R., and Kolker, E. (2002) Experimental protein mixture for validating tandem mass spectral analysis. Omics 6, 207 –212[CrossRef][Medline]

  23. Li, X. J., Zhang, H., Ranish, J. A., and Aebersold, R. (2003) Automated statistical analysis of protein abundance ratios from data generated by stable-isotope dilution and tandem mass spectrometry. Anal. Biochem. 75, 6648 –6657

  24. Crawford, G. C., Le, W., Smith, R. G., Xie, W. J., Stefani, E., and Appel, S. H. (1992) A novel N18TG2X mesencephalon cell hybrid express properties that suggest a dopaminergic cell line of substantia nigra origin. J. Neuorsci. 12, 3392 –3398

  25. Zhang, J., Price, J. O., Graham, D. G., and Montine, T. J. (1998) Secondary excitotoxicity contributes to dopamine-induced apoptosis of dopaminergic neuronal cultures. Biochem. Biophys. Res. Commun. 248, 812 –816[CrossRef][Medline]

  26. Zhang, J., Kravtsov, V., Amarnath, V., Picklo, M. J., Graham, D. G., and Montine, T. J. (2000) Enhancement of dopaminergic neurotoxicity by the mercapturate of dopamine: relevance to Parkinson’s disease. J. Neurochem. 74, 970 –978[CrossRef][Medline]

  27. Kinter, M., and Sherman, N. E. (2002) Protein Sequencing and Identification Using Tandem Mass Spectrometry , pp. 152 –160, John Wiley & Sons, New York

  28. Jacobsen, L. B., Calvin, S. A., Colvin, K. E., and Wright, M. (2004) FuGENE 6 Transfection Reagent: the gentle power. Methods 33, 104 –112[CrossRef][Medline]

  29. Zhang, J., Fitsanakis, V. A., Gu, G., Jing, D., Ao, M., Amarnath, V., and Montine, T. J. (2003) Manganese ethylene-bis-dithiocarbamate and selective dopaminergic neurodegeneration in rat: a link through mitochondrial dysfunction. J. Neurochem. 84, 336 –346[CrossRef][Medline]

  30. McNaught, K. S., and Jenner, P. (2001) Proteasomal function is impaired in substantia nigra in Parkinson’s disease. Neurosci. Lett. 297, 191 –194[CrossRef][Medline]

  31. Beal, M. F. (2003) Mitochondria, oxidative damage, and inflammation in Parkinson’s disease. Ann. N. Y. Acad. Sci. 991, 120 –131[CrossRef][Medline]

  32. Fiskum, G., Starkov, A., Polster, B. M., and Chinopoulos, C. (2003) Mitochondrial mechanisms of neural cell death and neuroprotective interventions in Parkinson’s disease. Ann. N. Y. Acad. Sci. 991, 111 –119[CrossRef][Medline]

  33. Dauer, W., and Przedborski, S. (2003) Parkinson’s disease: mechanisms and models. Neuron 39, 889 –909[CrossRef][Medline]

  34. Benecke, R., Strumper, P., and Weiss, H. (1993) Electron transfer complexes I and IV of platelets are abnormal in Parkinson’s disease but normal in Parkinson-plus syndromes. Brain 116, 1451 –1463[Abstract/Free Full Text]

  35. Haas, R. H., Nasirian, F., Nakano, K., Ward, D., Pay, M., Hill, R., and Shults, C. W. (1995) Low platelet mitochondrial complex I and complex II/III activity in early untreated Parkinson’s disease. Ann. Neurol. 37, 714 –722[CrossRef][Medline]

  36. Simon, D. K., Mayeux, R., Marder, K., Kowall, N. W., Beal, M. F., and Johns, D. R. (2000) Mitochondrial DNA mutations in complex I and tRNA genes in Parkinson’s disease. Neurology 54, 703 –709[Abstract/Free Full Text]

  37. Schapira, A. H., Cooper, J. M., Dexter, D., Jenner, P., Clark, J. B., and Marsden, C. D. (1989) Mitochondrial complex I deficiency in Parkinson’s disease. Lancet 1, 1269[Medline]

  38. Wadhwa, R., Taira, K., and Kaul, S. C. (2002) An Hsp70 family chaperone, mortalin/mthsp70/PBP74/Grp75: what, when, and where? Cell Stress Chaperones 7, 309 –316[CrossRef][Medline]

  39. Sherer, T. B., Kim, J. H., Betarbet, R., and Greenamyre, J. T. (2003) Subcutaneous rotenone exposure causes highly selective dopaminergic degeneration and {alpha}-synuclein aggregation. Exp. Neurol. 179, 9 –16[CrossRef][Medline]

  40. Sherer, T. B., Betarbet, R., Stout, A. K., Lund, S., Baptista, M., Panov, A. V., Cookson, M. R., and Greenamyre, J. T. (2002) An in vitro model of Parkinson’s disease: linking mitochondrial impairment to altered alpha-synuclein metabolism and oxidative damage. J. Neurosci. 22, 7006 –7015[Abstract/Free Full Text]

  41. Amanchy, R., Kalume, D. E., and Pandey, A. (2005) Stable isotope labeling with amino acids in cell culture (SILAC) for studying dynamics of protein abundance and posttranslational modifications. Sci. STKE 2005, pl 2

  42. Hoglinger, G. U., Carrard, G., Michel, P. P., Medja, F., Lombes, A., Ruberg, M., Friguet, B., and Hirsch, E. C. (2003) Dysfunction of mitochondrial complex I and the proteasome: interactions between two biochemical deficits in a cellular model of Parkinson’s disease. J. Neurochem. 86, 1297 –1307[Medline]

  43. Carr, S., Aebersold, R., Baldwin, M., Burlingame, A., Clauser, K., and Nesvizhskii, A. (2004) The need for guidelines in publication of peptide and protein identification data. Working Group on Publication Guidelines for Peptide and Protein Identification Data. Mol. Cell. Proteomics 3, 531 –533[Free Full Text]

  44. Wadhwa, R., Takano, S., Kaur, K., Aida, S., Yaguchi, T., Kaul, Z., Hirano, T., Taira, K., and Kaul, S. C. (2005) Identification and characterization of molecular interactions between mortalin/mthsp70 and hsp60. Biochem. J. 391, 185 –190[CrossRef][Medline]

  45. Kaul, S. C., Duncan, E. L., Englezou, A., Takano, S., Reddel, R. R., Mitsui, Y., and Wadhwa, R. (1998) Malignant transformation of NIH3T3 cells by overexpression of mot-2 protein. Oncogene 17, 907 –911[CrossRef][Medline]

  46. Kaul, S. C., Yaguchi, T., Taira, K., Reddel, R. R., and Wadhwa, R. (2003) Overexpressed mortalin (mot-2)/mthsp70/GRP75 and hTERT cooperate to extend the in vitro lifespan of human fibroblasts. Exp. Cell Res. 286, 96 –101[CrossRef][Medline]

  47. Dundas, S. R., Lawrie, L. C., Rooney, P. H., and Murray, G. I. (2005) Mortalin is over-expressed by colorectal adenocarcinomas and correlates with poor survival. J. Pathol. 205, 74 –81[CrossRef][Medline]

  48. Wadhwa, R., Takano, S., Taira, K., and Kaul, S. C. (2004) Reduction in mortalin level by its antisense expression causes senescence-like growth arrest in human immortalized cells. J. Gene Med. 6, 439 –444[CrossRef][Medline]

  49. Kumazaki, T., Wadhwa, R., Kaul, S. C., and Mitsui, Y. (1997) Expression of endothelin, fibronectin, and mortalin as aging and mortality markers. Exp. Gerontol. 32, 95 –103[CrossRef][Medline]

  50. Choi, J., Forster, M. J., McDonald, S. R., Weintraub, S. T., Carroll, C. A., and Gracy, R. W. (2004) Proteomic identification of specific oxidized proteins in ApoE-knockout mice: relevance to Alzheimer’s disease. Free Radic. Biol. Med. 36, 1155 –1162[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Evid Based Complement Alternat MedHome page
H. Kataria, N. Shah, S. C. Kaul, R. Wadhwa, and G. Kaur
Water Extract of Ashwagandha Leaves Limits Proliferation and Migration, and Induces Differentiation in Glioma Cells
Evid. Based Complement. Altern. Med., December 9, 2009; (2009) nep188v1.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Shi, J. Bradner, T. K. Bammler, D. L. Eaton, J. Zhang, Z. Ye, A. M. Wilson, T. J. Montine, C. Pan, and J. Zhang
Identification of Glutathione S-Transferase Pi as a Protein Involved in Parkinson Disease Progression
Am. J. Pathol., July 1, 2009; 175(1): 54 - 65.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
J. Jin, G. J. Li, J. Davis, D. Zhu, Y. Wang, C. Pan, and J. Zhang
Identification of Novel Proteins Associated with Both {alpha}-Synuclein and DJ-1
Mol. Cell. Proteomics, May 1, 2007; 6(5): 845 - 859.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Kimura, N. Tanaka, N. Nakamura, S. Takano, and S. Ohkuma
Knockdown of Mitochondrial Heat Shock Protein 70 Promotes Progeria-like Phenotypes in Caenorhabditis elegans
J. Biol. Chem., February 23, 2007; 282(8): 5910 - 5918.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. R. Richardson, W. M. Caudle, T. S. Guillot, J. L. Watson, E. Nakamaru-Ogiso, B. B. Seo, T. B. Sherer, J. T. Greenamyre, T. Yagi, A. Matsuno-Yagi, et al.
Obligatory Role for Complex I Inhibition in the Dopaminergic Neurotoxicity of 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)
Toxicol. Sci., January 1, 2007; 95(1): 196 - 204.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
M500382-MCP200v1
5/7/1193    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Glossary
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jin, J.
Right arrow Articles by Zhang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jin, J.
Right arrow Articles by Zhang, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Journal of Biological Chemistry 
 Journal of Lipid Research   ASBMB Today 
Advertisement
spacer
Advertisement
Advertisement