HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: M700077-MCP200v1 M700077-MCP200v2 7/1/15    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Glossary Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bai, Y. Articles by Schmitt-Ulms, G. Search for Related Content PubMed PubMed Citation Articles by Bai, Y. Articles by Schmitt-Ulms, G. Social Bookmarking                      What's this?

Molecular & Cellular Proteomics 7:15-34, 2008.
© 2008 by The American Society for Biochemistry and Molecular Biology, Inc.

---

Research

The in Vivo Brain Interactome of the Amyloid Precursor Protein^*,S

From the ^a Centre for Research in Neurodegenerative Diseases and Departments of ^d Laboratory Medicine and Pathobiology, ^h Medical Biophysics, ^k Medicine (Neurology), University of Toronto, Ontario M5S 3H2, Canada, ^g New York University School of Medicine, Orangeburg, New York 10962, ^j Alberta Centre for Prions and Protein Folding Diseases, University of Alberta, Alberta T6G 2M8, Canada, and ^l Toronto Western Hospital Research Institute, Toronto Western Hospital, Toronto, Ontario M5S 3H2, Canada

	ABSTRACT

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Despite intense research efforts, the physiological function and molecular environment of the amyloid precursor protein has remained enigmatic. Here we describe the application of time-controlled transcardiac perfusion cross-linking, a method for the in vivo mapping of protein interactions in intact tissue, to study the interactome of the amyloid precursor protein (APP). To gain insights into the specificity of reported protein interactions the study was extended to the mammalian amyloid precursor-like proteins (APLP1 and APLP2). To rule out sampling bias as an explanation for differences in the individual datasets, a small scale quantitative iTRAQ (isobaric tags for relative and absolute quantitation)-based comparison of APP, APLP1, and APLP2 interactomes was carried out. An interactome map was derived that confirmed eight previously reported interactions of APP and revealed the identity of more than 30 additional proteins that reside in spatial proximity to APP in the brain. Subsequent validation studies confirmed a physiological interaction between APP and leucine-rich repeat and Ig domain-containing protein 1, demonstrated a strong influence of Ig domain-containing protein 1 on the proteolytic processing of APP, and consolidated similarities in the biology of APP and p75.

Time-controlled transcardiac perfusion cross-linking (tcTPC) chemically links interacting proteins in vivo prior to the disruption of tissue integrity (23). It differs from standard perfusion fixation in that the cross-linking reagent is pumped through the circulatory system of the animal for only a short period of time, thereby allowing limited cross-linking to occur. As a result, tcTPC preserves physiological protein interactions and enables purification of protein complexes in the presence of high salt concentrations and detergents. These unique features of this protocol facilitate the downstream identification of cross-linked protein complex components by mass spectrometry.

In this report, we describe the application of tcTPC to study the molecular microenvironment of APP. Interactome maps were obtained following immunoprecipitation (IP) with antibodies that recognize non-overlapping epitopes of APP. To discriminate between APP-specific interactors and proteins that bind promiscuously to members of the APP family, we carried out comparative analyses of APP, APLP1, and APLP2 interactomes. Our data confirm previously reported interactions of APP with F-spondin, cystatin C, calsyntenin, calnexin, heat shock 70-kDa protein 5 (HSPA5, also known as BiP), prion protein (PrP), APLP1, and APLP2 and reveal more than 30 new protein interactions within the APP interactome. We demonstrate that the interactomes of APP, APLP1, and APLP2 are surprisingly different and demonstrate by quantitative and comparative iTRAQ analysis that this observation is not the result of sampling bias during LC/MS/MS analyses. Exemplary validation experiments on a novel APP candidate interactor, LINGO-1, confirm the interaction, demonstrate a strong correlation of APP and LINGO-1 expression in the brain, and suggest an important role for LINGO-1 in events that control the relative abundance of C-terminal APP fragments and secreted Aβ.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Antibodies—
The affinity-purified rabbit anti-APP intracellular domain antibody was raised against a synthetic peptide encompassing the terminal 45 amino acid residues of the APP cytoplasmic tail. The mouse monoclonal anti-APP extracellular domain antibody (clone mAmA3.2) was raised against the peptide antigen DAEFGHDSGFEVRHQC. Commercial rabbit antibodies specific for the C termini of APP (epitope MQQNGYENPTYKFFEQMQN), APLP1 (epitope NPTYRFLEERP), or APLP2 (epitope NPTYKYLEQMQI) were obtained from Sigma-Aldrich and Calbiochem (24). The polyclonal LINGO-1-directed antibody was obtained from Upstate/Millipore (Billerica, MA). Monoclonal anti-FLAG and anti-Aβ antibodies (6E10) were purchased from Sigma-Aldrich and Signet (Berkeley, CA), respectively.

tcTPC—
Mice were anesthetized intraperitoneally with Nembutal (sodium pentobarbital), and 0.2 ml of 1000 units/ml heparin solution was also administered to prevent blood clotting. Each mouse was placed on a gridiron mounted on top of a metal container. Muscular parts of the front paws were clamped with hemostats to stretch out the forelimbs. The chest was cut open in a caudal to rostral direction to the sternum along the sides of the rib cage and secured with either hemostats or retractor forceps. The tip of the heart was secured with forceps and then carefully clamped across with a curved hemostat. A slit was cut into the left ventricle, recognizable by its lighter color, into which a 30-mm-long 20-gauge needle with barrel tip, clamped into place with a hemostat and Luer lock hub, was inserted. The left atrium was cut, and the animal was perfused with saline at 25 ml/min for 2 min to purge the blood vessels. The success of this procedure was confirmed by a loss of color in the liver and the blood vessels that flank the midline of the rib cage. The perfusion was switched to fixative solution at 25 ml/min, and cross-linking was carried out for 6 min with the absence of blood in the tail and a hardening of the limbs of the animal signaling a successful perfusion. After perfusion, the brain was rapidly removed from the skull, postfixed in cross-linking reagent for up to 15 min at room temperature, and immediately frozen by immersion in liquid nitrogen. To increase the throughput of the tcTPC perfusions to 10/h, individual perfusions were initiated every 6 min in a procedure that required the parallel operation of two peristaltic pumps.

Purification of Cross-linked Complexes—
All steps were carried out at 4 °C. tcTPC-treated brains were pooled and homogenized with 30 strokes of 10 s each (PowerGen 120; Fischer Scientific) in 5 ml/brain homogenization buffer (50 mM NH₄Cl, 40 mM Tris, pH 8.0) supplemented with 1x Complete protease inhibitor mixture (Roche Applied Science). To ensure near quantitative extraction of membrane proteins, 25 ml/brain extraction buffer (20 mM NaCl, 0.6% deoxycholate, 0.6% Nonidet P-40, 20 mM Tris, pH 8.0) was added followed by a 5-min sonication in a water bath sonicator. Insoluble cellular debris were removed by a low speed centrifugation; the sample was dialyzed against 20 mM NaCl, 20 mM Tris, pH 8.0, and further cleared from insoluble material by high speed centrifugation (100,000 x g for 1 h); and then the supernatant was filtered through a 0.45-µm cartridge. To concentrate the dilute extract, samples were loaded onto self-packed Q-Sepharose HP (GE Healthcare) and eluted with a steep salt gradient. The eluate was dialyzed and adjusted to 100 mM NaCl, 1% Nonidet P-40, 20 mM Hepes, pH 7.3, and again centrifuged at 100,000 x g for 1 h. The cross-linked protein complexes were immunoaffinity-captured following covalent attachment of antibodies to chemically activated Affi-Gel 10 matrix (Bio-Rad). Alternatively antibodies used for large scale co-immunoprecipitations were cross-linked with 20 mM dimethyl pimelimidate to Protein A-agarose (Sigma-Aldrich) in the presence of 25 mM borax, pH 9.4, using standard procedures (30 min at room temperature). During immunocapture samples were agitated on a turning wheel for 24 h, washed extensively with 0.5 M NaCl, 0.05% SDS, 1% Nonidet P-40, 20 mM Hepes, pH 7.3, and then further washed with 10 mM NH₄HCO₃, pH 8.0. Proteins were eluted by a reduction in pH resulting from the addition of 0.2% trifluoroacetic acid, 20% acetonitrile.

Protein Reduction, Alkylation, and Trypsinization—
Protein-containing fractions were denatured in 6 M urea, 20 mM NH₄HCO₃, pH 8.0, followed by reduction with 1 mM tris(2-carboxyethyl)phosphine for 30 min at 60 °C and alkylation with 2.5 mM 4-vinylpyridine for 1 h at room temperature in the dark. Samples were diluted 4-fold to ensure that the concentration of urea did not exceed 1.5 M. Tryptic digestion was initiated by the addition of 1% (w/w) of side chain-modified, tosylphenylalanyl chloromethyl ketone-treated porcine trypsin and was allowed to proceed at 37 °C for 6 h.

iTRAQ Labeling—
Protein-containing fractions were denatured in 6 M urea, 20 mM NH₄HCO₃, pH 8.0, followed by reduction with 1 mM tris(2-carboxyethyl)phosphine for 20 min at 70 °C and alkylation with 2.5 mM methylmethanethiosulfonate for 1 h at room temperature in the dark. Following trypsinization, equal quantities of tryptic peptide mixtures were spiked with 1 pmol of synthetic [Glu¹]fibrinopeptide B (Sigma-Aldrich) to serve in the downstream analysis as an internal control for the efficiency of individual labeling reactions. Equal labeling with all four reagents was confirmed by equal intensities of 114:115:116:117 signature peaks upon forced fragmentation of the [Glu¹]fibrinopeptide B parent ion at 785. Any strong deviation from this ratio would have indicated problems with the labeling reaction or recovery of individual samples prior to the sample mixing step. Individual iTRAQ labeling reagents (Applied Biosystems, Foster City, CA) were reconstituted in ethanol, added to peptide mixtures derived from the tryptic digestion of IP eluates (control, iTRAQ114; APP, iTRAQ115; APLP1, iTRAQ116; APLP2, iTRAQ117) and incubated at room temperature in the dark for 1 h.

Two-dimensional Liquid Chromatography—
Strong cation exchange (SCX) chromatography was used to achieve peptide fractionation of the complex digest mixture. Samples digested with trypsin were adjusted to 25% acetonitrile and acidified (pH 3.0) by 20-fold dilution in 25% acetonitrile, 20 mM KH₂PO₄, pH 3.0. HPLC was carried out using the Ultimate System (Dionex, Sunnyvale, CA) equipped with a microflow calibration cartridge, a Valco injection port, and a 180-nl volume UV cell. Separation was achieved on a self-packed 0.5 x 110-mm Luna SCX (Phenomenex, Torrance, CA) column at a flow rate of 18 µl/min with a steep salt gradient from 0 to 400 mM NH₄Cl in 25% acetonitrile, 20 mM KH₂PO₄, pH 3.0. Fractions eluted from the SCX column were desalted with C₁₈ Empore (3M, Minneapolis, MN) stop and go extraction tips (25) and subsequently subjected to nanoflow reversed phase HPLC using the Ultimate LC system (Dionex, Sunnyvale, CA) equipped with a nanoflow calibration cartridge at a flow rate of 250 nl/min. Peptides were separated on a 75-µm-inner diameter self-packed column containing Proteo C₁₂ reversed phase matrix (Phenomenex) using a 100-min gradient from 2 to 34% acetonitrile in water with 0.1% (w/v) formic acid as the ion pairing agent.

ESI-Q-TOF Mass Spectrometry Analysis—
The column effluent was coupled directly via a fused silica capillary transfer line to a QSTAR XL hybrid quadrupole/time-of-flight tandem mass spectrometer (Applied Biosystems; MDS Sciex, Concord, Ontario, Canada) equipped with a MicroIonSpray source. The progress of each LC/MS run was monitored by recording the total ion current as a function of time for ions in the m/z range 300–1800. At 5-s intervals through the gradient, a mass spectrum was acquired for 1 s followed by one CID acquisition of 4 s each on ions selected by preset parameters of the information-dependent acquisition method using nitrogen as the collision gas. Singly charged ions were excluded from CID selection. The collision energy was adjusted automatically for each CID spectrum using an empirically optimized formula that considers the charge state and m/z value of the precursor ion.

Database Searches—
Peak lists for database searching were created using Mascot Distiller (Version 1, Matrix Science, London, UK). Searches were performed using designated MS/MS data interpretation algorithms within Protein Prospector (Version 4.21.3, University of California, San Francisco, CA) (26) and Mascot (Version 1.9, Matrix Science). Modifications considered were oxidation of methionine, phosphorylations of serine and threonine, N-terminal (pyro)Glu, and alkylation with 4-vinylpyridine. Searches further considered up to one missed cleavage and charge states ranging from +2 to +4. For a protein to be listed in the data tables it had to be identified by both search algorithms. In the few instances were only two peptides supported the identification of a protein, we required the underlying CID spectra to generate a Mascot score indicating a <5% probability that the match could be considered a random event (27) and further confirmed matches by the peptide sequence tag approach (28) and manual interpretation of spectra. As searches were carried out without species restriction the correct assignment of matches to mouse entries served as an additional internal control. All identifications were confirmed in repeat experiments done at a 2-fold lower scale. Please note that the vast majority of proteins were identified with Mascot scores of more than 100 thereby significantly exceeding thresholds conventionally applied for confident identifications. Further corroboration of APP interactome data was obtained from overlapping identifications obtained in co-IP experiments that utilized antibodies directed against non-overlapping domains of APP. The mass tolerance range between expected and observed masses used for database searches was ±150 ppm for MS peaks and ±0.15 Da for MS/MS fragment ions. These relatively large thresholds were used to capture more of the low intense peaks that frequently display broader distribution and thus are assigned with lower mass accuracy. Threshold levels were optimized based on LC/MS/MS datasets of tryptic digests of standard proteins. All samples were searched against the National Center for Biotechnology Information nonredundant database (NCBInr; release November 25, 2006) and a "decoy" database in which all entries of the above NCBI database had been inverted. With a view to provide a complete representation of the data, some weak assignments of CID spectra to peptides were included in supplemental data tables whenever strong CID spectra were also present that supported highly confident identifications of the respective proteins. The analysis of iTRAQ data was assisted by the software program ProQuant (Applied Biosystems; MDS Sciex). A feature of this software package was used to correct raw iTRAQ ratios for impurity levels of individual reagent lots determined by the manufacturer. To counteract the problem of low spectral counts present in a subset of spectra we set an intensity threshold for the combined intensities of iTRAQ signature peaks (40) that needed to be surpassed by a CID spectrum for it to be included in the calculation of averages and standard deviations of a given protein.

Co-immunoprecipitation—
Wild-type CD-1 mouse brains were homogenized in 50 mM Tris-HCl (pH 7.5) containing 1% CHAPSO, 150 mM NaCl, and protease inhibitor mixture (Sigma-Aldrich), hereafter referred to as Buffer A. Following incubation overnight with the primary antibody, immunocomplexes were captured by Protein A-agarose (Sigma-Aldrich) during a 2-h incubation step. Next beads were excessively washed with Buffer A, and bound proteins were eluted in denaturing Laemmli SDS gel loading buffer assisted by incubation at 95 °C for 10 min. Following SDS-PAGE separation on 4–20% Tris-glycine gels, proteins were electrophoretically transferred to PVDF membranes. For immunodetection Western blots were incubated overnight at 4 °C with primary antibodies and for 2 h at room temperature with horseradish peroxidase-conjugated secondary antibodies. Protein bands were visualized by ECL.

In Situ Hybridization—
Sections (6 µm) of formalin-fixed, paraffin-embedded mouse brains were cut using an RNase-free blade, mounted on slides, and dried overnight at 63 °C. Paraffin was removed by incubation in xylene followed by rehydration through a graded series of ethanol. Sections were postfixed in 10% formalin for 20 min, rinsed three times with TBS, and then incubated in 200 mM HCl for 15 min to denature proteins. Following three rinses with TBS, sections were placed in 0.5% acetic anhydride (in 0.1 M Tris-HCl, pH 8) for 10 min. Slides were rinsed three times with TBS and then incubated with 20 µg/ml proteinase K (Invitrogen) in TBS containing 2 mM CaCl₂ for 20 min at 37 °C. Sections were rinsed three times with TBS and then incubated in TBS at 4 °C for 5 min to stop the digestion. The sections were then dehydrated through a graded series of ethanol, incubated in chloroform for 20 min, rehydrated through decreasing concentrations of ethanol, and then incubated in 2x saline sodium citrate (SSC) for 5 min. Sections were prehybridized with hybridization buffer (2x SSC, 10% dextran sulfate, 0.01% sheared salmon sperm DNA, 0.02% SDS, 50% formamide) for 1 h at 56 °C. For hybridization, digoxigenin-labeled RNA probes were diluted 1:200 to 1:400 in hybridization buffer, and 40 µl of probe was applied per slide. The slides were coverslipped, heated at 95 °C for 5 min, and then hybridized overnight at 56 °C. Coverslips were removed by incubating the slides in 2x SSC for 15 min. Non-hybridized probe was removed by digestion with 20 µg/ml RNase A (Fermentas) in 0.5 M NaCl, 10 mM Tris-HCl, pH 8.0, for 30 min at room temperature. Sections were rinsed in 2x SSC and then incubated in 50% formamide, 1x SSC for 1 h at 56 °C to remove unbound probe. Sections were washed twice with 1x SSC for 15 min and then rinsed with TBS. Slides were blocked in blocking buffer (1x Blocking Reagent (Roche Applied Science) diluted in 0.1 M maleic acid, 0.15 M NaCl, pH 7.5) for 30 min at room temperature. Anti-digoxigenin antibody conjugated to alkaline phosphatase (Roche Applied Science) was diluted 1:500 in blocking buffer and then applied to the sections for 1 h at room temperature. Following two 15-min rinses with TBS, sections were incubated with detection buffer (0.1 M NaCl, 0.1 M Tris-HCl, pH 9.5) for 15 min. The alkaline phosphate substrate nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate was added, and color development was allowed to proceed overnight at room temperature in the dark.

Overexpression and Knockdown Analyses—
Full-length human LINGO-1 cDNA (gi accession number 15029688) equipped with a C-terminal FLAG tag was cloned into the pcDNA3.1d-TOPO vector (Invitrogen). Following sequence verification by primer walking the eukaryotic expression vector was transiently transfected into a human HEK293 cell line that stably expresses Swedish APP (APPsw). Cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum in the presence of 5% CO₂ at 37 °C. APP-derived C83 and C99 fragments were distinguished by their distinct molecular weight and by Western blotting with APP C terminus-directed antibodies (recognizing both C99 and C83) and 6E10 (recognizing only C99).

siRNA knockdown experiments of LINGO-1 were based on On-Target-Plus reagents (Dharmacon, Lafayette, CO) and the following siRNA pairs: Pair 1, GCUGGCGGCUCAACUUCAAUU (sense) and PUUGAAGUUGAGCCGCCAGCUU (antisense); Pair 2, ACACAAAGCACAACAUCGAUU (sense) and UCGAUGUUGUGCUUUGUGUUU (antisense); Pair 3, GGACUUCCCUGAUGUGCUAUU (sense) and PUAGCACAUCAGGGAAGUCCUU (antisense); and Pair 4, GAACAAGAUCGUUAUCCUAUU (sense) and PUAGGAUAACGAUCUUGUU (antisense). The siControl Non-Targeting Pool (D-001810-10) was used as a negative control. All transfections used the transfection reagent Lipofectamine 2000 (Invitrogen) according to the instructions of the manufacturer.

Aβ ELISA—
Aβ40 levels were measured as described previously by ELISA using 12–24-h conditioned APPsw HEK293 cell medium (29, 30).

Quantitative RT-PCR—
RNA was extracted from cells using the RNeasy Plus Mini kit (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions. First strand cDNA was synthesized from 2 µg of RNA using the StrataScript QPCR cDNA Synthesis kit (Stratagene, La Jolla, CA) according to the protocol provided with the kit. First strand cDNA was then diluted 1:5 with distilled water, and 5 µl (per reaction) was used in a 20-µl reaction volume of quantitative PCR with SYBR Premix Ex Taq (Perfect Real Time) (TaKaRa Bio Inc., Otsu, Japan) in an ABI 7500 Real-Time PCR System (Applied Biosystems) using β-actin-specific primer pairs (ACTB-F, 5'-AACTGGAACGGTGAAGGTGAC-3'; ACTB-R, 5'-CAACAATGTGCAATCAAAGTCC-3') and two LRRN6a-specific primer pairs (LRRN6a-A-F (5'-CACCTGCCCTCCTTCTACCA-3') and LRRN6a-A-R (5'-TCGTCGGCTTTCAACTCCA-3') and LRRN6a-B-F (5'-TGGGCTTCATCTCTTTCCTG-3') and LRRN6a-B-R (5'-GTGCTTTGTGTTGCCCTTG-3')). For the relative expression measure of LRRN6a, β-actin primers were used as an internal control. A standard comparative Ct method (ddCt method implemented in Sequence Detection Software version 1.3.1 (Applied Biosystems)) was used for the assessment of relative expression patterns compared with a calibration group (mock transfection).

	RESULTS

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
APP Interactome Mapping by tcTPC Procedure with a C Terminus-directed Antibody—
25 CD-1 mice were perfused in the presence of 4% formaldehyde for 15 min at room temperature. Cross-linking was stopped by immersion of the dissected target tissue into liquid nitrogen. Upon homogenization of the tissue of interest, residual formaldehyde was quenched with ammonium chloride and removed by dialysis. Due to the large volume of brain extracts used, the IP step was preceded by a protein concentration step using strong anion exchange chromatography. Target protein complexes were isolated by immunoaffinity purification in the presence of high salt concentration (0.5 M NaCl) and detergent (1% Nonidet P-40, 0.5% deoxycholate). The affinity purification step used an affinity-purified, APP C terminus-directed antibody that was covalently coupled to Affi-Gel 10, a chemically activated agarose matrix, and was carried out alongside a mock purification using an unspecific rabbit antibody. The extracted proteins were denatured in urea, alkylated with 4-vinylpyridine, and digested with trypsin. Resulting peptides were resolved on a strong cation exchange matrix into six fractions (Fig. 1A), which subsequently were subjected to on-line LC/MS/MS analysis (Fig. 1, B and C). A computational search of the non-redundant database at the National Center for Biotechnology Information (release November 25, 2006) with masses extracted from CID spectra identified candidate proteins cross-linked to C-terminal APP fragments during tcTPC. Searches against a "decoy database" in which all sequence entries of the above NCBI database were inverted did not give rise to any protein identification that passed significance thresholds we had applied, i.e. although searches of the decoy database indicated a low false positive rate with which CID spectra were assigned to individual peptides (with the strongest assignment achieving a Mascot score as high as 59), in no instance could more than one CID spectrum be assigned to the same protein entry in the decoy database, and none of the false positive peptide assignments belonged to a mouse protein. The immunoaffinity purification was repeated once, and only proteins were considered that consistently co-purified with the bait (Table I, part A). The identification of each of these proteins relied on strong CID spectra from at least two peptides. In fact, for each of the 20 most abundant proteins, more than 10% sequence coverage was recorded, and the strongest identifications were based on more than 50 unique CID spectra and 40% sequence coverage. A representative CID spectrum showing a continuous y-ion series spanning the entire tryptic peptide sequence LVFFAEDVGSNK contributed to the identification of APP as the most prominent component of these cross-linked complexes (Fig. 1C). Other nonspecific components were also present in eluate samples from this immunoaffinity purification as described below.

View larger version (23K): [in this window] [in a new window]   FIG. 1. Identification of molecular neighbors of APP by a combination of in vivo cross-linking, affinity capture, proteolytic fragmentation, two-dimensional liquid chromatography, and mass spectrometry. Mouse brains were subject to time-controlled transcardiac perfusion with formaldehyde to cross-link APP to its molecular neighbors. Complexes containing APP were then purified on an APP-specific immunoaffinity matrix. Following pH drop elution, captured proteins were trypsinized, and the complexity of the sample was reduced by two-dimensional liquid chromatography. A, UV trace from microbore HPLC strong cation exchange separation of trypsinized complexes containing APP. Six eluate samples were collected for subsequent capillary reversed phase HPLC separation and on-line ESI-MS/MS analysis. B, total ion current recorded during on-line reversed phase ESI-MS/MS analysis of representative cation exchange fraction indicated by the shaded areain panel A. C, representative CID spectrum generated from a [M + 2H]2+ ion at m/z 662.835 ([MH]+ 1324.69) which eluted from reversed phase column at time point indicated by the shaded area in panel B. In this spectrum the presence of both strong immonium ions in the low mass range and a continuous series of y-ions allowed high confidence assignment of the amino acid sequence (L/I)VFFAEDVGSNK, a tryptic peptide derived from APP. mAU, milliabsorbance units; aa, amino acids; Acc., accession.

View larger version (13K): [in this window] [in a new window]   FIG. 2. Schematic depiction of prominent biological fragments of APP and their detection with antibodies used for immunocapture in this work. It is generally assumed that alternative extracellular cleavages of APP with - and β-secretases are responsible for the release of sAPP and sAPPβ fragments, respectively. The concomitantly generated CTF and βCTF remain bound to the membrane and can subsequently be further truncated by /-secretase cleavage activities. The latter intramembrane proteolytic events cause the release of the AICD into the cytosol and the shedding of P3 (derived from CTF) or Aβ fragments (derived from βCTF) into the luminal/extracellular space. APP epitopes of the extracellular domain-directed monoclonal and the C terminus-directed polyclonal antibodies are indicated in this figure in dark gray shading and black, respectively.

View larger version (26K): [in this window] [in a new window]   FIG. 3. The APP protein family interactome. The schematic shows components of the APP interactome as nodes and their direct or indirect interactions as edges in this network. APP family members used as baits for co-immunoaffinity purification of cross-linked interactors are shown with white letters. Components identified in previous studies by other investigators are shown with red lines surrounding and red edges connecting the nodes. The latter interactions were found in Bind and DIP (dip.doe-mbi.ucla.edu) protein interaction databases accessed through the Cytoscape platform or identified by querying the PubMed reference library (www.ncbi.nlm.nih.gov/entrez/query.fcgi?DB=pubmed). The intensity of the green fill color for the nodes indicates the fractional sequence coverage with which individual components of this network were identified by tandem mass spectrometry, i.e. the darker the green color the greater the sequence coverage underlying the protein identification. Finally the shape of the nodes indicates whether a protein was identified in co-immunopurifications using an antibody directed against the C terminus (rectangular shape), the extracellular domain (oval shape), or both (rectangular with rounded corners) of the APP family member bait protein. For abbreviations of protein names please see Tables 1–3.

iTRAQ-based Semiquantitative Analysis of APP, APLP1, and APLP2 Interactomes Confirms Specificity of Interactions—
Mass spectrometry is not a quantitative analytical tool per se and in particular for complex samples is known to suffer from run-to-run variance. It can then be argued that differences in lists of candidate interactors may not reflect differences in physiologically relevant interactomes but are a consequence of sampling bias during LC/MS/MS analyses (31–33). To address this possibility mouse brains were subjected to the tcTPC procedure, and material for subsequent IPs was prepared as described above. The material was split into four equal volumes, and parallel IPs were carried out with equal quantities of mock IgG and C-terminal antibodies directed against APP, APLP1, and APLP2. Immunoaffinity eluates from the individual precipitations were reduced, alkylated, trypsinized, and labeled with iTRAQ reagents 114–117 (mock, iTRAQ114; APP, iTRAQ115; APLP1, iTRAQ116; APLP2, iTRAQ117). Following the labeling reaction the four samples were combined, the peptide mixture was fractionated by strong cation exchange, and individual fractions were analyzed by LC/MS/MS as described above (Fig. 4A). For computational protein identification the presence of iTRAQ adducts at the N terminus of peptides and in positions of lysine, arginine, and histidine were considered. The relative contribution of individual samples to the abundance of a given peptide was derived from the relative abundance of iTRAQ reporter group peaks at m/z of 114, 115, 116, and 117 in the CID spectrum. The relative quantity of individual proteins across the four samples was then determined by averaging the abundance ratios of thus quantified peptides (Table IV; see also supplemental Table 4).

View larger version (16K): [in this window] [in a new window]   FIG. 4. Semiquantitative comparison of interactomes of APP, APLP1, and APLP2 confirms preferential binding of BiP to APP. A, schematic representation of the strategy for quantitative and comparative analysis of APP family member interactomes. The formaldehyde cross-linking solution is pumped through the circulatory system of the mouse in a parameter-defined manner. Cross-linked protein complexes are stringently purified with target-specific antibodies recognizing the C termini of APP family members followed by alkylation and trypsinization. Digests from mock, APP, APLP1, and APLP2 affinity purifications are side-by-side iTRAQ-labeled and subsequently combined. Two-dimensional liquid chromatography of peptides is coupled to on-line ESI-MS/MS, which is followed by computationally aided protein identification and quantitation. B, BiP-derived peptide is specifically found in APP IP. Parallel co-IPs from wild-type mouse brain extract were followed by trypsinization of eluates and parallel iTRAQ labeling of peptides. iTRAQ labeling reactions were set up as indicated above, i.e. iTRAQ114 label, control antibody; iTRAQ115 label, APP; iTRAQ116 label, APLP1; and iTRAQ117 label, APLP2. Inset, high resolution graph depicting iTRAQ signature mass peaks. For information on additional peptides see supplemental Table 4. aa, amino acids.

Validation of LINGO-1 as a Physiological Interactor of APP—
To establish the biological significance of novel interactions revealed in this work we focused on LINGO-1, alias LRRN6a, a transmembrane protein that intriguingly was reported to bind to p75, a receptor that, just like APP, represents a substrate for intramembrane proteolytic cleavages mediated by the -secretase complex. Our interest in a possible interaction of LINGO-1 and APP was further sparked by the strong association of LINGO-1 with processes related to the myelination and regeneration of axons, both activities that also feature prominently in the APP literature. To assess the benefit of cross-linking for the detection of LINGO-1 and validate the biochemical interaction between APP and LINGO-1 we carried out a series of co-IP experiments with antibodies directed against APP or LINGO-1. As expected, formaldehyde cross-linking caused an overall loss of total protein (about 50%) that precipitates during ultracentrifugation as insoluble material (Fig. 5A). The SDS-PAGE analysis of the soluble ultracentrifugation supernatant derived from tcTPC-treated brains led to the detection of poorly resolved bands in the high molecular weight region of the gel (Fig. 5B) that included APP-containing cross-linked products (Fig. 5C). Solubilizing detergents seemed to disrupt the interaction between APP and LINGO-1 because LINGO-1 was only detectable in co-IPs derived from cross-linked brain extracts (Fig. 5D). Reciprocal co-IPs further supported the conclusion that LINGO-1 is associated with APP in the brain. Taken together, the above experiments confirmed binding of endogenous LINGO-1 to APP in the brain and corroborated our conceptual choice to incorporate a cross-linking step in the experimental procedure (Fig. 5E). LINGO-1 belongs to a subfamily of single span transmembrane proteins harboring leucine-rich repeats that also includes LINGO-2, LINGO-3, and LINGO-4. Members of this family share more than 30% sequence identity (>80% sequence homology) and have been reported to exhibit distinct expression patterns with LINGO-1 expression being largely restricted to the brain. We decided to use in situ hybridization (ISH) of brain sections to investigate whether there is a correlation in the expression pattern of LINGO-1 and APP in the mouse brain. Antisense ISH probes specific for both proteins showed remarkable consistency in both the distribution and relative intensity with which individual subregions in the brain were stained. No staining above background levels was observed in negative control ISH experiments in which sense strand riboprobes were used. Consistent with previous reports both LINGO-1 and APP messenger RNAs gave rise to pronounced staining of CA1 to CA3 neurons and less staining in neurons within the dentate gyrus of the hippocampus formation (Fig. 5F).

View larger version (54K): [in this window] [in a new window]   FIG. 5. Biochemical analyses validate benefit of cross-linking step and corroborate interaction of APP and LINGO-1. A, CD-1 mice were subjected to transcardiac perfusion with PBS (Lane 1) or formaldehyde in PBS (Lane 2). Brains were rapidly dissected and homogenized in extraction buffer, and the yield of soluble protein was determined by bicinchoninic acid assay following ultracentrifugation (100,000 x g for 1 h at 4 °C). B, formaldehyde cross-linking by tcTPC causes changes in the molecular weight distribution of proteins that can be visualized by standard SDS-PAGE and Coomassie staining. Please note the increased smearing of protein bands in the top half of the gel commonly observed in cross-linked samples (Lane 2). C, successful formaldehyde cross-linking of APP by the tcTPC method monitored by Western blotting (WB) with APP-directed antibody. As expected, formaldehyde cross-linking caused a reduction in full-length uncross-linked APP protein that can be recovered in soluble form. Cross-linked products containing APP give rise to a continuous and poorly resolved smear in the high molecular mass region (>100 kDa) of the Western blot. D, cross-linking is essential for the detection of the interaction between APP and LINGO-1 by co-IP. Extracts generated for A were subjected to co-IP with mouse monoclonal APP-directed antibody (M3.2). Despite successful IP of APP in both uncross-linked (Lane 2) and cross-linked samples (Lane 3), LINGO-1 is only detectable in IP eluates derived from cross-linked brain extracts (Lane 3). E, reciprocal co-IP further corroborated interaction of APP and LINGO-1. Following transcardiac perfusion of CD-1 mice a polyclonal LINGO-1 antibody was used to co-IP LINGO-1 and interacting proteins. Western blotting analysis led to robust detection of endogenous LINGO-1 and APP in IP eluate fraction (Lane 5). In contrast, a control IP carried out alongside with unspecific rabbit IgG did not immunoprecipitate LINGO-1 and gave rise to only a weak signal when probed with the APP-specific antibody (Lane 4). F, in situ hybridization reveals strong regional correlation of APP and LINGO-1 mRNA transcription in mouse brain. Antisense and sense cRNA probes specific for APP and LINGO-1 were hybridized to hippocampus formation of wild-type C57/B6 mice. Sections were not counterstained, and blue staining from nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate represents hybridization to mRNA. neg., negative.

View larger version (21K): [in this window] [in a new window]   FIG. 6. LINGO-1 affects A β levels by influencing competing APP cleavage reactions mediated by - and β-secretases. A, quantitative RT-PCR confirmed knockdown of endogenous LINGO-1 at the mRNA level. The bar diagram, which summarizes data from three independent biological repetitions and two non-overlapping LRRN6a-specific primer pairs (Lingo-1-A and Lingo-1-B), confirmed knockdown of endogenous LRRN6a to about 0.15 of the levels observed following transfection with unspecific mock siRNA. B, Western blotting establishes efficient knockdown of LINGO-1 protein in HEK293 APPsw cells. To verify knockdown of LINGO-1 at the protein level HEK293 APPsw cells were transiently co-transfected with an expression vector encoding for LINGO-1-FLAG and either a pool of LINGO-1-specific knockdown siRNAs or a pool of unspecific siRNAs. C, siRNA knockdown of endogenous LINGO-1 is paralleled by reduction in Aβ secreted from HEK293 APPsw cells. HEK293 APPsw cells were transiently transfected with a pool of LINGO-1-specific siRNAs. Aβ levels determined by a highly sensitive sandwich ELISA revealed statistically significant (p < 0.001) reduction of Aβ levels of more than 25% (71 ± 3% (mean ± S.E.)). D, reduction of endogenous LINGO-1 levels by siRNA is paralleled by a selective increase in the levels of the -secretase cleavage product C83 (170 ± 4% (mean ± S.E.)). Yet the increase in C83 levels is not paralleled by changes in the expression level of full-length APP. E, reduction of LINGO-1 levels by treatment of HEK293 APPsw cells with a pool of LINGO-1-specific siRNAs is paralleled by a reduction (63 ± 3% (mean S.E.)) in levels of the β-secretase cleavage product C99. Again no change is observed in levels of full-length APP. F, overexpression of LINGO-1-FLAG in HEK293 APPsw cells is paralleled by an increase in C99 levels (131 ± 3.4% (mean ± S.E.)). Please note that all observations were statistically significant with a p value <0.001. The recognition of C83 and C99 fragments was based on their distinct molecular weight and Western blotting with 6E10, an antibody that recognizes the C99 proteolytic APP fragment but not C83 (not shown).

	DISCUSSION

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We nevertheless expect that only a subset of proteins on the list of potential APP binding partners are bona fide interactors that are important for the biology of APP. Others might reside in spatial proximity to APP in vivo without affecting its biology. Furthermore it is conceivable that not all proteins on this list were directly cross-linked to APP. The degree of cross-linking conferred by tcTPC clearly was limited as it did not interfere with (i) independent immunoprecipitation of APP from cross-linked complexes with two different antibodies, (ii) efficient tryptic digestion of cross-linked complexes, or (iii) tandem mass spectrometry-based identifications of complex components that generally were derived from CID spectra showing extensive stretches of unmodified amino acids. To our knowledge, there is no technical element in this procedure that would favor a certain class of target proteins; therefore, we suggest that the absence of known APP interactors, such as the proteolytically active secretases and FE65, in our dataset might be due to the short lived nature of their interactions, a lack of exposed side chains that could be cross-linked by formaldehyde, or competition of interactor and APP-specific antibody for the same binding site within APP. Whether such interactions would be captured by tcTPC if larger quantities of brain tissue or longer reaction times were used remains to be determined.

APP and ER-resident Chaperones—
As maturation of APP occurs during its passage through the secretory pathway, we expected to find various ER- and Golgi-resident proteins in our APP-specific dataset. Indeed binding of APP to various members of ER-resident chaperones had been reported previously in various contexts (35–39). Intriguingly our APP dataset not only contained a few ER chaperones but was populated by an astonishing number of proteins known to participate in various aspects of ER-based folding and the unfolded protein response. It is tempting to attribute this observation to the notorious tendency of chaperones to show up in various affinity purification eluates as a result of unspecific binding. However, to our surprise, we did not see a similar representation of chaperones in the side-by-side collected APLP1- and APLP2-specific datasets (Tables II and III) despite the high degree of homology between these proteins, and the quantitative iTRAQ comparison of IP datasets (Table IV) argues against sampling bias as the underlying cause for this observation. Further investigations are needed to reveal whether interactions of APP with ER chaperones merely provide better substrates for cross-link reactions or whether the cell dispatches an extensive armor of chaperones to APP to avoid detrimental effects that may ensue if APP maturation goes wrong.

In Vivo Interactions of APP, APLP1, and APLP2—
Extensive studies in various knock-out models strongly argued for genetic interactions among mammalian APP family proteins. Genetic studies further suggested at least some distinct physiological roles for APLP2 and APP and established that APLP2 gene ablation contributes most strongly to double knock-out phenotypes (19, 20, 22). A direct biochemical interaction, however, had not been reported until recently when it was shown that APP can engage in homo- and heterodimerization with its mammalian homologs (17). The independent presence of APLP1 and APLP2 in both APP-directed co-immunoprecipitation datasets presented here corroborates these observations and establishes biochemical interaction of these proteins also in the living brain. Please note that this conclusion could not be firmly drawn if we had based our interactome analysis solely on the APP C terminus-directed antibody as this antibody was raised against a C-terminal fragment of APP that over its length shows weak similarity to homologous regions within APLP1 and APLP2. The extracellular domain-specific APP antibody, however, was raised against a short internal APP sequence for which no equivalent can be found in APLP1 and APLP2, thereby strongly arguing against antibody cross-reactivity as the explanation for this observation. Assuming the interaction of APP and APLP2 is functionally relevant, insights into the biology of APP may be derived from studying the interactome of APLP1 and -2. For example our observation that APP did not cross-link to kinesin-1 but may have access to a similar motor protein of the kinesin family, Kif-1A, through its interaction with APLP2 might be of interest for investigations surrounding this controversial issue (13, 14).

Other Previously Reported Interactions—
Our data also corroborate previous reports on interactions of APP with other proteins. In a previous tcTPC interactome dataset of the PrP we reported the presence of APP in the vicinity of PrP and NCAM (23). During the preparation of this manuscript, an involvement of PrP in the regulation of β-secretase-mediated APP cleavage was reported (40). Genetic and biochemical evidence has linked fasciclin II and the insect APP ortholog APP-like (APPL) to a common regulatory pathway involved in synapse formation (41). NCAM1 and the grasshopper protein fasciclin II share 28% amino acid identity over the entire extracellular domain suggesting that insect fasciclin II and vertebrate NCAMs probably evolved from a common ancestral molecule. The here reported binding of NCAM1 to APP may thus represent a meaningful cellular event conserved throughout evolution. We also found strong CIDs for calsyntenins, also known as alcadeins, a novel family of proteins known to associate with APP in the brain by forming a tripartite complex with X11L (42, 43). Finally our dataset contains cystatin C, an extracellular protease inhibitor reported previously to co-deposit with Aβ in brain arteriolar walls (44) and AD amyloid plaques (45). Co-deposition of cystatin C with Aβ was also observed in hereditary cerebral hemorrhage with amyloidosis-Dutch type, a cerebrovascular amyloidosis caused by a rare mutation within APP (46, 47), and in transgenic mice overexpressing the Swedish APP double mutation (48). Cystatin C has also been implicated in APP biology by independent studies that suggested genetic association between polymorphisms in the coding region of the cystatin C gene and late onset AD (49–52).

One previous attempt to map APP interactors by combining large scale co-immunoprecipitations with two-dimensional gel separation of candidate interactors and downstream protein identification by mass spectrometry has been reported (53). The authors separated IP eluates on a two-dimensional gel followed by in-gel trypsinization of candidate bands and reported the identification of 21 proteins that co-immunoprecipitated with APP-directed antibodies. Although the significance of candidate interactors remains unclear it is of concern that half of the reported proteins in that study were found in our unspecific mock pulldown dataset (for example tubulin, Munc18, actin, 14-3-3, myelin basic protein, and glial fibrillary acidic protein), and the most strongly represented protein was not APP but tubulin.

Similarities in the Biology of APP and p75—
Following the logic of "guilt by association," the cellular function of a protein can frequently be inferred from its next neighbor relationship with other proteins of known function (54). When viewed from this angle our data support the notion that APP protein family members may play a role in neuritogenesis (LINGO-1, mental disorder-associated GTPase activating protein (MEGAP), reticulon, and neurofascin), cell adhesion (Thy-1, NCAM1, and contactin), and synapse formation (GABA-B1a and NCAM1; see below).

Also our data consolidated intriguing parallels in the biology of APP and p75. Like APP, p75 has been shown recently to represent an - and -secretase substrate (54–57). APP as well as p75 has also been repeatedly proposed to localize to rafts, specialized membrane regions enriched in GPI-anchored proteins, cholesterol, and sphingolipids (58). The presence of four well known GPI-anchored molecules, contactin, Thy-1, PrP, and NCAM1-GPI, in the APP interactome presented here is in agreement with this notion. Both APP and p75 appear to be directed by Vps10p domain-containing retromer proteins into recycling pathways (15, 16, 59). Although p75 serves as a receptor for nerve growth factor, the equivalent extracellular ligand for APP remains unclear. Our data, however, further corroborate the previously reported interaction of F-spondin as a physiological extracellular ligand for APP (3) and suggest that APP may indirectly have access to VGF8a through its interaction with APLP1. Our data also establish LINGO-1, alias LRRN6a, as an APP-interacting protein. To our knowledge, the only other proteins known to interact with LINGO-1 are Taj/Troy and, again, p75 (60). Apparently to promote axonal branching and regeneration, p75 engages in heterotrimeric interactions with LINGO-1 and the GPI-anchored Nogo receptor (61). It has been shown previously that ligands of this receptor complex, reticulons 1–4, influence the level of BACE1-mediated Aβ generation (62). It has further been shown that both p75 itself and the Nogo receptor, another protein harboring leucine-rich-repeat domains, affect APP processing (63–65). However, whereas there is an inverse relationship between Nogo receptor and secreted Aβ levels, LINGO-1 appears to promote Aβ secretion. Finally the heterotrimeric complex containing p75 mediates its biological effects through activation of the small GTPase rho (66). Our APP interactome map also includes a strong hit for srGAP3, alias MEGAP, a rho-activating protein, and suggests that APP may have indirect access to rho through its interaction with APLP2 (Table III). Interestingly both srGAP3, short for slit-robo GTPase-activating protein 3, and LINGO-1 have been implicated in slit-robo-like signaling in the brain. In fact, LINGO-1 was originally discovered in a sequence database search for human slit orthologs selectively expressed in brain (61). Please note that LINGO-1 and srGAP3 were identified in this work in independent IPs with APP-specific antibodies directed against extracellular and intercellular domains, respectively.

LINGO-1 and LRRTM3—
During the preparation of this manuscript a study was published that reported on the identification of a novel APP interactor, LRRTM3, identified based on a genomic in vitro siRNA screen for genes that regulate APP processing in HEK293T cells (67). Interestingly LRRTM3 belongs to the same protein superfamily of leucine-rich repeat (LRR) domain-harboring proteins as LINGO-1, and as such the two proteins display considerable sequence similarity (27.1% sequence similarity and 17.7% sequence identity). Clearly the relative contribution of LRRTM3 and LINGO-1 to the biology of APP will have to be addressed in a separate study. It is noteworthy, however, that LINGO-1 and LRRTM3 appear to demonstrate an inverse expression pattern within neuronal formations of the hippocampus, i.e. whereas APP and LINGO-1 expression levels are high in the CA1 to CA3 region and low in the dentate gyrus, LRRTM3 expression levels are reported to be particularly high in neurons of the dentate gyrus, and only modest expression of LRRTM3 was documented in CA1 to CA3 neurons (67). Despite this disparity in expression levels, the presence of LINGO-1 or LRRTM3 appears to exert a strikingly similar effect on the processing of APP fragments in cell culture assays. It remains to be seen whether promiscuous binding of APP to a subset of LRR domain-harboring proteins in cell culture paradigms and competition of LRR-harboring proteins (Nogo receptor, LINGO-1, and LRRTM3) for binding to APP underlie some of these observations. Our data suggest a model in which LINGO-1 may facilitate access of BACE1 to APP and thereby promote cleavage at the β-cleavage site. Consistent with this hypothesis, the experimental reduction of LINGO-1 causes a reduction of both C99 and Aβ fragments as well as an increase in the secretion of the -secretase cleavage product C83. Although our data indicate that LINGO-1 may exert this effect on APP cleavage through direct interaction, more work will be needed to gain mechanistic insights. Plausible modes of action include, but are not limited to, recruitment of APP to sites of β-secretase activity, stabilization of the enzyme-substrate complex, or inhibition of alternative cleavage by -secretase.

Concluding Remarks—
In summary, this work represents the most comprehensive analysis of the APP interactome to date. It sheds light on a molecular framework of APP interactions that may underlie proposed functional roles of APP in neuritogenesis/axonal regeneration, cell adhesion, and synaptogenesis. Intensive validation work will be required to more fully appreciate the role of individual proteins in the APP network presented here. It is hoped that further investigations of this network will reveal an "Achilles’ heel" in the molecular biology of APP that can be exploited for diagnostic or therapeutic purposes.

	FOOTNOTES

 
Received, February 20, 2007, and in revised form, July 10, 2007.

Published, MCP Papers in Press, October 13, 2007, DOI 10.1074/mcp.M700077-MCP200

¹ The abbreviations used are: AD, Alzheimer disease; Aβ, amyloid β-peptide; AICD, APP intracellular domain; APP, amyloid precursor protein; APLP1, amyloid precursor-like protein 1; APLP2, amyloid precursor-like protein 2; ER, endoplasmic reticulum; GPI, glycosylphosphatidylinositol; IP, immunoprecipitation; LINGO, LRR and Ig domain-containing, Nogo receptor interacting protein; LRR, leucine-rich repeat; tcTPC, time-controlled transcardiac perfusion cross-linking; TM, transmembrane; iTRAQ, isobaric tags for relative and absolute quantitation; PrP, prion protein; SCX, strong cation exchange; CHAPSO, 3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonic acid; HEK, human embryonic kidney; APPsw, Swedish APP; siRNA, small interfering RNA; NCBI, National Center for Biotechnology Information; NCBInr, NCBI nonredundant database; NCAM, neural cell adhesion molecule; sAPP, soluble APP; EBP4.1, erythrocyte band 4.1 protein; ISH, in situ hybridization; CTF, -cleavage C-terminal fragment of APP; βCTF, β-cleavage C-terminal fragment of APP; GAP, GTPase-activating protein; SSC, saline sodium citrate; MEGAP, mental disorder-associated GTPase activating protein.

² P. Mathews, personal communication.

^* This work was supported by Canadian Institutes for Health Research (CIHR) Grant MOP-74734, the Canadian Foundation for Innovation (CIHR Grant 10087), and National Institutes of Health Grant GM61898.

^S The on-line version of this article (available at http://www.mcponline.org) contains supplemental material.

^b Both authors contributed equally to this work.

^c Funded through the CIHR Strategic Program in Protein Folding.

^e Received fellowship support (Grant 20059) from the University of Toronto.

^f Present address: Samuel Lunenfeld Research Inst., Toronto, Ontario M5G 1X5, Canada.

ⁱ Supported by the Alzheimer Society of Ontario and Ontario Mental Health Foundation.

^m Received generous support from the W. Garfield Weston Foundation. To whom correspondence should be addressed. E-mail: g.schmittulms{at}utoronto.ca.

	REFERENCES

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Haass, C. (2004 ) Take five—BACE and the -secretase quartet conduct Alzheimer’s amyloid β peptide generation. EMBO J. 23, 483 –488[CrossRef][Medline]

2. Selkoe, D. J. (2001 ) Alzheimer’s disease: genes, proteins, and therapy. Physiol. Rev. 81, 741 –766[Abstract/Free Full Text]

3. Ho, A., and Sudhof, T. C. (2004 ) Binding of F-spondin to amyloid-β precursor protein: a candidate amyloid-β precursor protein ligand that modulates amyloid-β precursor protein cleavage. Proc. Natl. Acad. Sci. U. S. A. 101, 2548 –2553[Abstract/Free Full Text]

4. Nishimoto, I., Okamoto, T., Matsuura, Y., Takahashi, S., Murayama, Y., and Ogata, E. (1993 ) Alzheimer amyloid protein precursor complexes with brain GTP-binding protein G_o. Nature 362, 75 –79[CrossRef][Medline]

5. Borg, J. P., Ooi, J., Levy, E., and Margolis, B. (1996 ) The phosphotyrosine interaction domains of X11 and FE65 bind to distinct sites on the YENPTY motif of amyloid precursor protein. Mol. Cell. Biol. 16, 6229 –6241[Abstract]

6. Fiore, F., Zambrano, N., Minopoli, N., Donini, G., Duilio, A., and Russo, T. (1995 ) The regions of the Fe65 protein homologous to the phosphotyrosine interaction/phosphotyrosine binding domain of SHc bind the intracellular domain of the Alzheimer’s amyloid precursor protein. J. Biol. Chem. 270, 30853 –30856[Abstract/Free Full Text]

7. Trommsdorff, M., Borg, J. P., Margolis, B., and Herz, J. (1998 ) Interaction of cytosolic adaptor proteins with neuronal apolipoprotein E receptors and the amyloid precursor protein. J. Biol. Chem. 273, 33556 –33560[Abstract/Free Full Text]

8. Van Gassen, G., Annaert, W., and Van Broeckhoven, C. (2000 ) Binding partners of Alzheimer’s disease proteins: are they physiologically relevant? Neurobiol. Dis. 7, 135 –151[CrossRef][Medline]

9. Kimberly, W. T., Zheng, J. B., Guenette, S. Y., and Selkoe, D. J. (2001 ) The intracellular domain of the β-amyloid precursor protein is stabilized by Fe65 and translocates to the nucleus in a notch-like manner. J. Biol. Chem. 276, 40288 –40292[Abstract/Free Full Text]

10. Zheng, P., Eastman, J., Pol, S. V., and Pimplikar, S. W. (1998 ) PAT1, a microtubule-interacting protein, recognizes the basolateral sorting signal of amyloid precursor protein. Proc. Natl. Acad. Sci. U. S. A. 95, 14745 –14750[Abstract/Free Full Text]

11. Kamal, A., Almenar-Queralt, A., LeBlanc, J. F., Roberts, E. A., and Goldstein, L. S. (2001 ) Kinesin-mediated axonal transport of a membrane compartment containing β-secretase and presenilin-1 requires APP. Nature 414, 643 –648[CrossRef][Medline]

12. Kamal, A., Stokin, G. B., Yang, Z., Xia, C. H., and Goldstein, L. S. (2000 ) Axonal transport of amyloid precursor protein is mediated by direct binding to the kinesin light chain subunit of kinesin-1. Neuron 28, 449 –459[CrossRef][Medline]

13. Stokin, G. B., Lillo, C., Falzone, T. L., Brusch, R. G., Rockenstein, E., Mount, S. L., Raman, R., Davies, P., Masliah, E., Williams, D. S., and Goldstein, L. S. (2005 ) Axonopathy and transport deficits early in the pathogenesis of Alzheimer’s disease. Science 307, 1282 –1288[Abstract/Free Full Text]

14. Lazarov, O., Morfini, G. A., Lee, E. B., Farah, M. H., Szodorai, A., DeBoer, S. R., Koliatsos, V. E., Kins, S., Lee, V. M., Wong, P. C., Price, D. L., Brady, S. T., and Sisodia, S. S. (2005 ) Axonal transport, amyloid precursor protein, kineasin-1 and the processing apparatus: revisited. J. Neurosci. 25, 2386 –2395[Abstract/Free Full Text]

15. Andersen, O. M., Reiche, J., Schmidt, V., Gotthardt, M., Spoelgen, R., Behlke, J., Von Arnim, C. A., Breiderhoff, T., Jansen, P., Wu, X., Bales, K. R., Cappai, R., Masters, C. L., Gliemann, J., Mufson, E. J., Hyman, B. T., Paul, S. M., Nykjaer, A., and Willnow, T. E. (2005 ) Neuronal sorting protein-related receptor sorLA/LR11 regulates processing of the amyloid precursor protein. Proc. Natl. Acad. Sci. U. S. A. 102, 13461 –13466[Abstract/Free Full Text]

16. Rogaeva, E., Meng, Y., Lee, J. H., Gu, Y., Kawarai, T., Zou, F., Katayama, T., Baldwin, C. T., Cheng, R., Hasegawa, H., Chen, F., Shibata, N., Lunetta, K. L., Pardossi-Piquard, R., Boehm, C., Wakutani, Y., Cupples, A. L., Cuenco, K. T., Green, R., Pinessi, L., Rainero, I., Sorbi, S., Bruni, A., Duara, R., Friedland, R., Inzelberg, R., Hampe, W., Bujo, H., Song, Y.-Q., Fraser, P. E., Andersen, O., Graff-Radford, N., Petersen, R., Dickson, D., Der, S. D., Fraser, P., Schmitt-Ulms, G., Younkin, S., Mayeux, R., Farrer, L., and St. George-Hyslop, P. (2007 ) The neuronal sortilin-related receptor SORL1 is genetically associated with Alzheimer disease. Nat. Genet. 39, 168 –177[CrossRef][Medline]

17. Soba, P., Eggert, S., Wagner, K., Zentgraf, H., Siehl, K., Kreger, S., Lower, A., Langer, A., Merdes, G., Paro, R., Masters, C. L., Muller, U., Kins, S., and Beyreuther, K. (2005 ) Homo- and heterodimerization of APP family members promotes intercellular adhesion. EMBO J. 24, 3624 –3634[CrossRef][Medline]

18. Reinhard, C., Hebert, S. S., and De Strooper, B. (2005 ) The amyloid-β precursor protein: integrating structure with biological function. EMBO J. 24, 3996 –4006[CrossRef][Medline]

19. Heber, S., Herms, J., Gajic, V., Hainfellner, J., Aguzz, A., Rulicke, T., von Kretzschmar, H., von Koch, C., Sisodia, S. S., Tremml, P., Lipp, H. P., Wofer, D. P., and Muller, U. (2000 ) Mice with combined gene knock-outs reveal essential and partially redundant functions of amyloid precursor protein family members. J. Neurosci. 20, 7951 –7963[Abstract/Free Full Text]

20. Herms, J., Aniker, B., Heber, S., Ring, S., Fuhrmann, M., Kretzschmar, H., Sisodia, S. S., and Muller, U. (2004 ) Cortical dysplasia resembling human type 2 lissencephaly in mice lacking all three APP family members. EMBO J. 23, 4106 –4115[CrossRef][Medline]

21. Leyssen, M., Ayaz, D., Herbert, S. S., Reeve, S., De Strooper, B., and Hassan, B. A. (2005 ) Amyloid precursor protein promotes post-developmental neurite arborization in the Drosophila brain. EMBO J. 24, 2944 –2955[CrossRef][Medline]

22. Zheng, H., Jiang, M., Trumbauer, M. E., Sirinathsinghji, D. J., Hopkins, R., Smith, D. W., Heavens, R. P., Dawson, G. R., Boyce, S., and Conner, M. W. (1995 ) β-Amyloid precursor protein-deficient mice show reactive gliosis and decreased locomotor activity. Cell 81, 525 –531[CrossRef][Medline]

23. Schmitt-Ulms, G., Hansen, K., Liu, J., Cowdrey, C., Yang, J., DeArmond, S., Cohen, F. E., Prusiner, S. B., and Baldwin, M. A. (2004 ) Time-controlled transcardiac perfusion crosslinking for the study of protein interactions in complex tissues. Nat. Biotechnol. 22, 724 –731[CrossRef][Medline]

24. Thinakaran, G., Kitt, C. A., Roskams, A. J., Slunt, H. H., Masliah, E., von Koch, C., Ginsberg, S. D., Ronnett, G. V., Reed, R. R., and Price, D. L. (1995 ) Distribution of an APP homolog, APLP2, in the mouse olfactory system: a potential role for APLP2 in axogenesis. J. Neurosci. 15, 6314 –6326[Abstract/Free Full Text]

25. Rappsilber, J., Ishihama, Y., and Mann, M. (2003 ) Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal. Chem. 75, 663 –670[Medline]

26. Chalkley, R. J., Baker, P. R., Huang, L., Hansen, K. C., Allen, N. P., Rexach, M., and Burlingame, A. L. (2005 ) Comprehensive analysis of a multidimensional liquid chromatography mass spectrometry dataset acquired on a quadrupole selecting quadrupole collision cell, time-of-flight mass spectrometer. II. New developments in Protein Prospector allow for reliable and comprehensive automatic analysis of large datasets. Mol. Cell. Proteomics 4, 1194 –1204[Abstract/Free Full Text]

27. Perkins, D. N., Pappin, D. J., Creasy, D. M., and Cottrell, J. S. (1999 ) Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20, 3551 –3567[CrossRef][Medline]

28. Mann, M., and Wilm, M. (1994 ) Error-tolerant identification of peptides in sequence databases by peptides sequence tags. Anal. Chem. 66, 4390 –4399[Medline]

29. Yu, G. (2000 ) A novel protein (nicastrin) modulates presenilin-mediated Notch/Glp1 and βAPP processing. Nature 407, 48 –54[CrossRef][Medline]

30. Chen, F. (2002 ) Presenilin 1 mutations activate 42-secretase but reciprocally inhibit -secretase cleavage of amyloid precursor protein (APP) and S3-cleavage of notch. J. Biol. Chem. 277, 36521 –36526[Abstract/Free Full Text]

31. Liu, H., Sadygov, R. G., and Yates, J. R. (2004 ) A model for random sampling and estimation of relative protein abundance in shotgun proteomics. Anal. Chem. 76, 4193 –4201[Medline]

32. Steen, H., and Mann, M. (2004 ) The ABC’s (and XYZ’s) of peptide sequencing. Nat. Rev. Mol. Cell Biol. 5, 699 –711[CrossRef][Medline]

33. Tabb, D. L., MacCross, M. J., Wu, C. C., Anderson, S. D., and Yates, J. R. (2003 ) Similarity among tandem mass spectra from proteomics experiments: detection, significance, and utility. Anal. Chem. 75, 2470 –2477[Medline]

34. Chen, F., Hasegawa, H., Schmitt-Ulms, G., Kawarai, T., Bohm, C., Katayama, T., Gu, Y., Sanjo, N., Glista, M., Rogaeva, E., Wakutani, Y., Pardossi-Piquard, R., Ruan, X., Tandon, A., Checler, F., Marambaud, P., Hansen, K., Westaway, D., St. George-Hyslop, P. H., and Fraser, P. (2006 ) TMP21 is a presenilin complex component that modulates -secretase but not -secretase activity. Nature 440, 1208 –1212[CrossRef][Medline]

35. Erickson, R. R., Dunning, L. M., Olson, D. A., Cohen, S. J., Davis, A. T., Wood, W. G., Kratzke, R. A., and Holtzman, J. L. (2005 ) In cerebrospinal fluid ER chaperones ERp57 and calreticulin bind β-amyloid. Biochem. Biophys. Res. Commun. 332, 50 –57[CrossRef][Medline]

36. Johnson, R. J., Xiao, G., Shanmugaratnam, J., and Fine, R. E. (2001 ) Calreticulin functions as a molecular chaperone for the β-amyloid precursor protein. Neurobiol. Aging 22, 387 –395[CrossRef][Medline]

37. Kogel, D., Schomburg, R., Schurmann, T., Reimertz, C., Konig, H. G., Poppe, M., Eckert, A., Muller, W. E., and Prehn, J. H. (2003 ) The amyloid precursor protein protects PC12 cells against endoplasmic reticulum stress-induced apoptosis. J. Neurochem. 87, 248 –256[CrossRef][Medline]

38. Vattemi, G., Engel, K., McFerrin, J., and Askanas, V. (2004 ) Endoplasmic reticulum stress and unfolded protein response in inclusion body myositis muscle. Am. J. Pathol. 164, 1 –7[Abstract/Free Full Text]

39. Yang, Y., Turner, R. S., and Gaut, J. R. (1998 ) The chaperone BiP/GRP78 binds to amyloid precursor protein and decreases Aβ40 and Aβ42 secretion. J. Biol. Chem. 273, 25552 –25555[Abstract/Free Full Text]

40. Parkin, E. T., Watt, N. T., Hussain, I., Eckman, E. A., Eckman, C. B., Manson, J. C., Baybutt, H. N., Turner, A. J., and Hooper, N. M. (2007 ) Cellular prion protein regulates β-secretase cleavage of the Alzheimer’s amyloid precursor protein. Proc. Natl. Acad. Sci. U. S. A. 104, 11062 –11067[Abstract/Free Full Text]

41. Ashley, J., Packard, M., Ataman, B., and Budnik, V. (2005 ) Fasciclin II signals new synapse formation through amyloid precursor protein and the scaffolding protein dX11/Mint. J. Neurosci. 25, 5943 –5955[Abstract/Free Full Text]

42. Araki, Y., Miyagi, N., Kato, N., Yoshida, T., Wada, S., Nishimura, M., Komano, H., Yamamoto, T., De Strooper, B., Yamamoto, K., and Suzuki, T. (2004 ) Coordinated metabolism of alcadein and amyloid β-protein precursor regulates FE65-dependent gene transactivation. J. Biol. Chem. 279, 24343 –24354[Abstract/Free Full Text]

43. Araki, Y., Tomita, S., Yamaguchi, H., Miyagi, N., Sumioka, A., Kirino, Y., and Suzuki, T. (2003 ) Novel cadherin-related membrane proteins, alcadeins, enhance the X11-like protein-mediated stabilization of amyloid β-protein precursor metabolism. J. Biol. Chem. 278, 49448 –49458[Abstract/Free Full Text]

44. Vinters, H. V., Nishimura, G. S., Secor, D. L., and Pardridge, W. M. (1990 ) Immunoreactive A4 and gamma-trace peptide colocalization in amyloidotic arteriolar lesions in brains of patients with Alzheimer’s disease. Am. J. Pathol. 137, 233 –240[Abstract]

45. Sastre, M., Calero, M., Pawlik, M., Mathews, P. M., Kumar, A., Danilov, V., Schmidt, S. D., Nixon, R. A., Frangione, B., and Levy, E. (2004 ) Binding of cystatin C to Alzheimer’s amyloid β inhibits in vitro amyloid formation. Neurobiol. Aging 25, 1033 –1043[CrossRef][Medline]

46. Bornebroek, M., Haan, J., Maat-Schieman, M. L., Van Duinen, S. G., and Roos, R. A. (1996 ) Hereditary cerebral hemorrhage with amyloidosis-Dutch type (HCHWA-D). I. A review of clinical, radiologic and genetic aspects. Brain Pathol. 6, 111 –114[Medline]

47. Maat-Schieman, M. L., Van Diunen, S. G., Bornebroek, M., Haan, J., and Roos, R. A. (1996 ) Hereditary cerebral hemorrhage with amyloidosis-Dutch type (HCHWA-D). II. A review of histopathological aspects. Brain Pathol. 6, 115 –120[Medline]

48. Steinhoff, T., Moritz, E., Wollmer, M. A., Mohajeri, M. H., Kins, S., and Nitsch, R. M. (2001 ) Increased cystatin C in astrocytes of transgenic mice expressing the K670N-M671L mutation of the amyloid precursor protein and deposition in brain amyloid plaques. Neurobiol. Dis. 8, 647 –654[CrossRef][Medline]

49. Beyer, K., Lao, J. L., Gomez, M., Riutort, N., Latorre, P., Mate, J. L., and Ariza, A. (2001 ) Alzheimer’s disease and the cystatin C gene polymorphism: an association study. Neurosci. Lett. 315, 17 –20[CrossRef][Medline]

50. Crawford, F. C., Freeman, M. J., Schinka, J. A., Abdullah, L. I., Gold, M., Hartman, R., Krivian, K., Morris, M. D., Richards, D., Duara, R., Anand, R., and Mullan, M. J. (2000 ) A polymorphism in the cystatin C gene is a novel risk factor for late-onset Alzheimer’s disease. Neurology 55, 763 –768[Abstract/Free Full Text]

51. Finckh, U., Von der Kammer, H., Velden, J., Michel, T., Andresen, B., Deng, A., and Zhang, J. (2000 ) Genetic association of a cystatin C gene polymorphism with late-onset Alzheimer disease. Arch. Neurol. 57, 1579 –1583[Abstract/Free Full Text]

52. Olson, J. M., Goddard, K. A., and Dudek, D. M. (2002 ) A second locus for very-late-onset Alzheimer disease: a genome scan reveals linkage to 20p and epistasis between 20p and the amyloid precursor protein region. Am. J. Hum. Genet. 71, 154 –161[CrossRef][Medline]

53. Cottrell, B., Galvan, V., Banwait, S., Gorostiza, O., Lombardo, C., Williams, T., Schilling, B., Peel, A., Gibson, B., Koo, E. H., Link, C. D., and Bredesen, D. E. (2005 ) A pilot proteomic study of amyloid precursor interactors in Alzheimer’s disease. Ann. Neurol. 58, 277 –289[CrossRef][Medline]

54. Vazquez, A., Flammini, A., Maritan, A., and Vespignani, A. (2003 ) Global protein function prediction from protein-protein interaction networks. Nat. Biotechnol. 21, 697 –700[CrossRef][Medline]

55. Domeniconi, M., Zampieri, N., Spencer, T., Hilaire, M., Mellado, W., Chao, M. V., and Filbin, M. T. (2005 ) MAG induces regulated intramembrane proteolysis of the p75 neurotrophin receptor to inhibit neurite outgrowth. Neuron 46, 839 –840[CrossRef][Medline]

56. Kanning, K. C., Hudson, M., Amieux, P. S., Wiley, J. C., Bothwell, M., and Schecterson, L. C. (2003 ) Proteolytic processing of the p75 neurotrophin receptor and two homologs generates C-terminal fragments with signaling capability. J. Neurosci. 23, 5424 –5436

57. Zampieri, N., Xu, C. F., Neubert, T. A., and Chao, M. V. (2005 ) Cleavage of p75 neurotrophin receptor by -secretase and -secretase requires specific receptor domains. J. Biol. Chem. 280, 14563 –14571[Abstract/Free Full Text]

58. Yu, W., Guo, W., and Feng, L. (2004 ) Segregation of Nogo66 receptors into lipid rafts in rat brain and inhibition of Nogo66 signaling by cholesterol depletion. FEBS Lett. 57, 87 –92

59. Nykjaer, A., Lee, R., Teng, K. K., Jansen, P., Madsen, P., Nielsen, M. S., Jacobsen, C., Kliemannel, M., Schwarz, E., Willnow, T. E., Hempstead, B. L., and Petersen, C. M. (2004 ) Sortilin is essential for proNGF-induced neuronal cell death. Nature 427, 798 –799[CrossRef][Medline]

60. Shao, Z., Browning, J. L., Lee, X., Scott, M. L., Shulga-Morskaya, S., Allaire, N., Thill, G., Levesque, M., Sah, D., McCoy, J. M., Murray, B., Jung, V., Pepinsky, R. B., and Mi, S. (2005 ) Taj/Troy, an orphan TNF receptor family member, binds Nogo-66 receptor 1 and regulates axonal regeneration. Neuron 45, 353 –359[CrossRef][Medline]

61. Mi, S., Lee, X., Shao, Z., Thill, G., Ji, B., Relton, J., Levesque, M., Allaire, N., Perrin, S., Sands, B., Crowell, T., Cate, R. L., McCoy, J. M., and Pepinsky, R. B. (2004 ) LINGO-1 is a component of the Nogo-66 receptor/p75 signaling complex. Nat. Neurosci. 7, 221 –228[CrossRef][Medline]

62. He, W., Lu, Y., Qahwash, I., Hu, X. Y., Chang, A., and Yan, R. (2004 ) Reticulon family members modulate BACE1 activity and amyloid-β peptide generation. Nat. Med. 10, 959 –965[CrossRef][Medline]

63. Park, J. H., Gimbel, D. A., GrandPre, T., Lee, J. K., Kim, J. E., Li, W., Lee, D. H., and Strittmatter, S. M. (2006 ) Alzheimer precursor protein interaction with the Nogo-66 receptor reduces amyloid-β plaque deposition. J. Neurosci. 26, 1386 –1395[Abstract/Free Full Text]

64. Park, J. H., Widi, G. A., Gimbel, D. A., Harel, N. Y., Lee, D. H., and Strittmatter, S. M. (2006 ) Subcutaneous Nogo receptor removes brain amyloid-β and improves spatial memory in Alzheimer’s transgenic mice. J. Neurosci. 26, 13279 –13286[Abstract/Free Full Text]

65. Costantini, C., Weindruch, R., Della Valle, G., and Puglielli, L. (2005 ) A TrkA-to-p75^NTR molecular switch activates amyloid β-peptide generation during aging. Biochem. J. 391, 59 –67[CrossRef][Medline]

66. Yamashita, T., Tucker, K. L., and Barde, Y. A. (1999 ) Neurotrophin binding to the p75 receptor modulates rho activity and axonal outgrowth. Neuron 24, 585 –593[CrossRef][Medline]

67. Majercak, J., Ray, W. J., Espeseth, A., Simon, A., Shi, X. P., Wolffe, C., Getty, K., Marine, S., Stec, E., Ferrer, M., Strulovici, B., Bartz, S., Gates, A., Xu, M., Huang, Q., Ma, L., Shughrue, P., Burchard, J., Colussi, D., Pietrak, B., Kahana, J., Beher, D., Rosahl, T., Shearman, M., Hazuda, D., Sachs, A. B., Koblan, K. S., Seabrook, G. R., and Stone, D. J. (2006 ) LRRTM3 promotes processing of amyloid-precursor protein by BACE1 and is a positional candidate gene for late-onset Alzheimer’s disease. Proc. Natl. Acad. Sci. U. S. A. 103, 17967 –17972[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				D. Kaden, P. Voigt, L.-M. Munter, K. D. Bobowski, M. Schaefer, and G. Multhaup Subcellular localization and dimerization of APLP1 are strikingly different from APP and APLP2 J. Cell Sci., February 1, 2009; 122(3): 368 - 377. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: M700077-MCP200v1 M700077-MCP200v2 7/1/15    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Glossary Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bai, Y. Articles by Schmitt-Ulms, G. Search for Related Content PubMed PubMed Citation Articles by Bai, Y. Articles by Schmitt-Ulms, G. Social Bookmarking                      What's this?