Advertisement

Global Interactomics Uncovers Extensive Organellar Targeting by Zika Virus*

Open AccessPublished:August 28, 2020DOI:https://doi.org/10.1074/mcp.TIR118.000800
      Zika virus (ZIKV) is a membrane enveloped Flavivirus with a positive strand RNA genome, transmitted by Aedes mosquitoes. The geographical range of ZIKV has dramatically expanded in recent decades resulting in increasing numbers of infected individuals, and the spike in ZIKV infections has been linked to significant increases in both Guillain-Barré syndrome and microcephaly. Although a large number of host proteins have been physically and/or functionally linked to other Flaviviruses, very little is known about the virus-host protein interactions established by ZIKV. Here we map host cell protein interaction profiles for each of the ten polypeptides encoded in the ZIKV genome, generating a protein topology network comprising 3033 interactions among 1224 unique human polypeptides. The interactome is enriched in proteins with roles in polypeptide processing and quality control, vesicle trafficking, RNA processing and lipid metabolism. >60% of the network components have been previously implicated in other types of viral infections; the remaining interactors comprise hundreds of new putative ZIKV functional partners. Mining this rich data set, we highlight several examples of how ZIKV may usurp or disrupt the function of host cell organelles, and uncover an important role for peroxisomes in ZIKV infection.

      Graphical Abstract

      Zika virus (ZIKV)
      The abbreviations used are:
      ZIKV
      Zika virus
      BioID
      proximity-dependent biotin identification
      CB
      Cajal body
      CRISPR
      clustered regularly interspersed short palindromic repeats
      C
      capsid protein
      DENV
      Dengue virus
      Env
      ZIKV envelope protein
      GO
      gene ontology
      IF
      immunofluorescence
      NS1–5
      ZIKV nonstructural viral proteins 1–5
      PreM
      ZIKV pre-membrane/membrane protein
      sh/siRNA
      short hairpin/small interfering RNA
      UPS
      ubiquitin-proteasome system.
      1The abbreviations used are:ZIKV
      Zika virus
      BioID
      proximity-dependent biotin identification
      CB
      Cajal body
      CRISPR
      clustered regularly interspersed short palindromic repeats
      C
      capsid protein
      DENV
      Dengue virus
      Env
      ZIKV envelope protein
      GO
      gene ontology
      IF
      immunofluorescence
      NS1–5
      ZIKV nonstructural viral proteins 1–5
      PreM
      ZIKV pre-membrane/membrane protein
      sh/siRNA
      short hairpin/small interfering RNA
      UPS
      ubiquitin-proteasome system.
      is a mosquito-borne (Aedes aegypti and Ae. Albopictus) single-stranded positive sense RNA arbovirus of the Flaviviridae family (
      • Petersen L.R.
      • Jamieson D.J.
      • Powers A.M.
      • Honein M.A.
      Zika Virus.
      ,
      • Chen H.L.
      • Tang R.B.
      Why Zika virus infection has become a public health concern?.
      ). Named after its discovery in the Zika forest of Uganda in 1947 (
      • Dick G.W.
      • Kitchen S.F.
      • Haddow A.J.
      Zika virus. I. Isolations and serological specificity.
      ), ZIKV remained confined to Africa until recent outbreaks in Micronesia (2007) (
      • Duffy M.R.
      • Chen T.H.
      • Hancock W.T.
      • Powers A.M.
      • Kool J.L.
      • Lanciotti R.S.
      • Pretrick M.
      • Marfel M.
      • Holzbauer S.
      • Dubray C.
      • Guillaumot L.
      • Griggs A.
      • Bel M.
      • Lambert A.J.
      • Laven J.
      • Kosoy O.
      • Panella A.
      • Biggerstaff B.J.
      • Fischer M.
      • Hayes E.B.
      Zika virus outbreak on Yap Island, Federated States of Micronesia.
      ), French Polynesia (2013) (
      • Cao-Lormeau V.M.
      • Roche C.
      • Teissier A.
      • Robin E.
      • Berry A.L.
      • Mallet H.P.
      • Sall A.A.
      • Musso D.
      Zika virus, French polynesia, South pacific, 2013.
      ), and South America (2015–2016) (
      • Zanluca C.
      • Melo V.C.
      • Mosimann A.L.
      • Santos G.I.
      • Santos C.N.
      • Luz K.
      First report of autochthonous transmission of Zika virus in Brazil.
      ,
      • Campos G.S.
      • Bandeira A.C.
      • Sardi S.I.
      Zika Virus Outbreak, Bahia, Brazil.
      ). Local transmission of ZIKV has now been reported in >50 countries (
      • Poland G.A.
      • Kennedy R.B.
      • Ovsyannikova I.G.
      • Palacios R.
      • Ho P.L.
      • Kalil J.
      Development of vaccines against Zika virus.
      ).
      Most ZIKV infections are asymptomatic, though ∼20% of infected individuals develop flu-like symptoms (rash, fever, joint pain) that resolve after a few days. Notably, however, ZIKV can infect human neural progenitors and post-mitotic neurons (
      • Tang H.
      • Hammack C.
      • Ogden S.C.
      • Wen Z.
      • Qian X.
      • Li Y.
      • Yao B.
      • Shin J.
      • Zhang F.
      • Lee E.M.
      • Christian K.M.
      • Didier R.A.
      • Jin P.
      • Song H.
      • Ming G.L.
      Zika virus infects human cortical neural progenitors and attenuates their growth.
      ,
      • Lin M.Y.
      • Wang Y.L.
      • Wu W.L.
      • Wolseley V.
      • Tsai M.T.
      • Radic V.
      • Thornton M.E.
      • Grubbs B.H.
      • Chow R.H.
      • Huang I.C.
      Zika virus infects intermediate progenitor cells and post-mitotic committed neurons in human fetal brain tissues.
      ). Consistent with these observations, recent ZIKV outbreaks have been linked to significant increases in Guillain-Barré syndrome ((
      • Gatherer D.
      • Kohl A.
      Zika virus: a previously slow pandemic spreads rapidly through the Americas.
      ) an autoimmune disorder affecting neuromuscular function) and microcephaly (
      • Blazquez A.B.
      • Saiz J.C.
      Neurological manifestations of Zika virus infection.
      ,
      • Li C.
      • Xu D.
      • Ye Q.
      • Hong S.
      • Jiang Y.
      • Liu X.
      • Zhang N.
      • Shi L.
      • Qin C.F.
      • Xu Z.
      Zika virus disrupts neural progenitor development and leads to microcephaly in mice.
      ,
      • Devhare P.
      • Meyer K.
      • Steele R.
      • Ray R.B.
      • Ray R.
      Zika virus infection dysregulates human neural stem cell growth and inhibits differentiation into neuroprogenitor cells.
      ,
      • Mlakar J.
      • Korva M.
      • Tul N.
      • Popovic M.
      • Poljsak-Prijatelj M.
      • Mraz J.
      • Kolenc M.
      • Resman Rus K.
      • Vesnaver Vipotnik T.
      • Fabjan Vodusek V.
      • Vizjak A.
      • Pizem J.
      • Petrovec M.
      • Avsic Zupanc T.
      Zika virus associated with microcephaly.
      ), leading the WHO to declare a Public Health Emergency of International Concern. To date, no antiviral drugs or vaccines are available for the treatment or prevention of ZIKV infection.
      Phosphatidylserine receptors of the TIM (T-cell immunoglobulin and mucin domain) and TAM (TYRO, AXL, MER) families are candidate ZIKV receptors (
      • Merfeld E.
      • Ben-Avi L.
      • Kennon M.
      • Cerveny K.L.
      Potential mechanisms of Zika-linked microcephaly.
      ,
      • Perera-Lecoin M.
      • Meertens L.
      • Carnec X.
      • Amara A.
      Flavivirus entry receptors: an update.
      ). Following receptor binding, virus endocytosis and vesicle acidification, the 10.7 kb RNA genome is released into the host cell cytoplasm. A single polyprotein is translated from this RNA, then proteolytically cleaved into three structural (Capsid: C; precursor membrane protein: PreM; Env: Envelope) and seven nonstructural (NS) polypeptides (NS1, 2A, 2B, 3, 4A, 4B, and 5) (
      • Kuno G.
      • Chang G.J.
      Full-length sequencing and genomic characterization of Bagaza, Kedougou, and Zika viruses.
      ,
      • Shankar A.
      • Patil A.A.
      • Skariyachan S.
      Recent perspectives on genome, transmission, clinical manifestation, diagnosis, therapeutic strategies, vaccine developments, and challenges of Zika virus research.
      ). Viral particle assembly occurs in the endoplasmic reticulum, following a dramatic reorganization of host endomembranes (reviewed in (
      • Wang A.
      • Thurmond S.
      • Islas L.
      • Hui K.
      • Hai R.
      Zika virus genome biology and molecular pathogenesis.
      )).
      sh/siRNA and CRISPR-Cas9-based screens have identified several host factors required for ZIKV infection and replication (
      • Savidis G.
      • McDougall W.M.
      • Meraner P.
      • Perreira J.M.
      • Portmann J.M.
      • Trincucci G.
      • John S.P.
      • Aker A.M.
      • Renzette N.
      • Robbins D.R.
      • Guo Z.
      • Green S.
      • Kowalik T.F.
      • Brass A.L.
      Identification of Zika virus and Dengue virus dependency factors using functional genomics.
      ,
      • Marceau C.D.
      • Puschnik A.S.
      • Majzoub K.
      • Ooi Y.S.
      • Brewer S.M.
      • Fuchs G.
      • Swaminathan K.
      • Mata M.A.
      • Elias J.E.
      • Sarnow P.
      • Carette J.E.
      Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.
      ,
      • Yasunaga A.
      • Hanna S.L.
      • Li J.
      • Cho H.
      • Rose P.P.
      • Spiridigliozzi A.
      • Gold B.
      • Diamond M.S.
      • Cherry S.
      Genome-wide RNAi screen identifies broadly-acting host factors that inhibit arbovirus infection.
      ). Importantly, however, very little is known regarding individual ZIKV protein - host protein interactions. Here, we present a BioID/IP-MS ZIKV-host interactome. Overall, the interactome is significantly enriched in proteins associated with polypeptide processing and quality control, vesicle trafficking, RNA processing machinery and proteins linked to lipid metabolism. Notably, the data set also highlights extensive organellar targeting by ZIKV proteins. For example, we report that: (1) the ZIKV Capsid protein is targeted to a variety of host endomembrane locations and can “remodel” nuclear/ER membranes; (2) the NS5 helicase protein is targeted to, and partially disrupts, Cajal Bodies; (3) the NS3-NS2B protease interacts with the HOPS/CORVET complex, and modifies lysosome volume, and; (4) NS2A is specifically targeted to peroxisomal membranes. Consistent with this observation, we demonstrate that peroxisome function is linked to efficient ZIKV replication in culture. Together, the ZIKV-host interactome thus provides a valuable resource for better understanding ZIKV biology and identifies numerous virus-host protein interactions that could be targeted in antiviral therapeutic strategies.

      EXPERIMENTAL PROCEDURES

      Experimental Design and Statistical Rationale

      Both BioID and anti-Flag IP-MS analyses were performed on each of the ten ZIKV polypeptides, expressed individually in HEK293 T-REx cells, fused either with an N-terminal FlagBirA* or a C-terminal BirA*Flag epitope tag. MS samples prepared from two biological replicates were each analyzed twice (i.e. four MS runs) on a Thermo Q-Exactive HF quadrupole-Orbitrap mass spectrometer. For each prey protein, all four sample runs were compared against the two highest peptide counts among 16 control samples, prepared from HEK293 T-REx cells expressing the FlagBirA* tag alone (see below). Protein IDs with at least two unique peptides and an iProphet score >0.9 (corresponding to ∼1% FDR) were defined as high-confidence interactors, when their Bayesian False Discovery Rate (BFDR) assigned by SAINT Express (v3.6) was below 1% (supplemental Table S1). Additional details provided below.

      Cell Lines, Virus, and Transfection

      Individual ZIKV polypeptide sequences were generated by gene synthesis (BioBasics, Markham, ON, Canada; based on Genbank sequence ANO46305.1, and cleavage sites reported in (
      • Kuno G.
      • Chang G.J.
      Full-length sequencing and genomic characterization of Bagaza, Kedougou, and Zika viruses.
      ); full sequence information available on Prohits-web.lunenfeld.ca), and subcloned using AscI/NotI sites into pcDNA5.1 FRT/TO FlagBirA*- (N-terminal tagging), FRT/TO -BirA*Flag (C-terminal tagging), pcDNA3 GFP-, or pcDNA3 mCherry- plasmids. FAM134B was amplified with Q5 polymerase (NEB, Ipswich, MA) from HEK293 cDNA, with the following primers: KpnI-Fwd: TATAGGTACCATGGCGAGCCCGGCGCCTCCGG and AscI_Rev AAGGCGCGCCTTACTTGTCGTCATCGTCTTTGTAGTCGGCATGGCCTCCCAGCA GATTTG, and inserted into pcDNA3. Epitope-tagged ZIKV coding vectors were transfected with PolyJet (Signagen, Rockville, MD), and expressed in human Flp-In T-REx 293 cells (Invitrogen, Carlsbad, CA) or HeLa cells (as described in (
      • Coyaud E.
      • Mis M.
      • Laurent E.M.
      • Dunham W.H.
      • Couzens A.L.
      • Robitaille M.
      • Gingras A.C.
      • Angers S.
      • Raught B.
      BioID-based identification of Skp Cullin F-box (SCF)beta-TrCP1/2 E3 ligase substrates.
      )). Protein expression was induced by adding 1 μg/ml tetracycline to the culture medium (DMEM, 10% fetal calf serum, Gibco, Waltham, MA) for 24 h. 293 T-REx cells were maintained at 37 °C in DMEM supplemented with 10% fetal bovine serum, 10 mm HEPES (pH 8.0) and 1% penicillin-streptomycin. HeLa cells were cultured under the same conditions. Human fibroblasts were cultured in DMEM with l-glutamine (Wisent, St-Bruno, QC, Canada) supplemented with 10% fetal bovine serum (Gibco) at 37 °C in humidified air with 5% CO2. Vero cells were cultured in MEM with l-glutamine supplemented with 5% fetal bovine serum at 37 °C and 5% CO2. ZIKV (ZIKV/Homo sapiens/PRI/PRVABC59/2015, Genbank accession no. KX087101.2) was amplified in Vero cells using MEM supplemented with l-glutamine and 1% fetal bovine serum. Plasmids were transfected using Lipofectamine-2000 (Invitrogen) following the manufacturer's instructions.

      Zika Virus Infection

      Cells at 70% confluence were rinsed with PBS, and virus diluted in growth medium supplemented with l-glutamine and 1% FBS. Virus inoculum was removed after 1 h and replaced with fresh media. Cells and supernatants were harvested at the indicated times post-infection for determination of TCID50.

      Flag Affinity Purification

      5 × 150 cm2 dishes of subconfluent (80%) 293 T-REx cells expressing the protein of interest were scraped into PBS, pooled, washed twice in 10 ml PBS, and collected by centrifugation at 1000 × g for 5 min at 4 °C. Cell pellets were stored at −80 °C until lysis. The cell pellet was weighed, and 1:4 pellet weight/lysis buffer (by volume) was added. Lysis buffer consisted of 50 mm HEPES-NaOH (pH 8.0), 100 mm KCl, 2 mm EDTA, 0.1% Nonidet P-40, 10% glycerol, 1 mm PMSF, 1 mm DTT, and 1:500 protease inhibitor mixture (Sigma-Aldrich, St. Louis, MO). On resuspension, cells were incubated on ice for 10 min, subjected to one additional freeze-thaw cycle, then centrifuged at 27,000 × g for 20 min at 4 °C. The supernatant was transferred to a fresh 15 ml conical tube, and 1:1000 turbonuclease (BioVision, Milpitas, CA) plus 30 μl packed, pre-equilibrated Flag-M2 agarose beads (Sigma-Aldrich) were added. The mixture was incubated for 2 h at 4 °C with end-over-end rotation. Beads were pelleted by centrifugation at 1000 × g for 1 min and transferred with 1 ml of lysis buffer to a fresh centrifuge tube. Beads were washed once with 1 ml lysis buffer and twice with 1 ml ammonium bicarbonate (ammbic) rinsing buffer (50 mm ammbic, pH 8.0, 75 mm KCl). Elution was performed by incubating the beads with 150 μl of 125 mm ammonium hydroxide (pH ∼11). The elution step was repeated twice, and the combined eluate centrifuged at 15,000 × g for 1 min, transferred to a fresh centrifuge tube, and lyophilized.

      Biotin-streptavidin Affinity Purification

      Cell pellets were resuspended in 10 ml of lysis buffer (50 mm Tris-HCl pH 7.5, 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% Triton X-100, 0.1% SDS, 1:500 protease inhibitor mixture (Sigma-Aldrich), 1:1000 turbonuclease), incubated on an end-over-end rotator at 4 °C for 1 h, briefly sonicated to disrupt any visible aggregates, then centrifuged at 16,000 × g for 30 min at 4 °C. The supernatant was transferred to a fresh 15 ml conical tube, 30 μl of packed, pre-equilibrated streptavidin-Sepharose beads (GE, Boston, MA) were added, and the mixture incubated for 3 h at 4 °C with end-over-end rotation. Beads were pelleted by centrifugation at 2000 rpm for 2 min and transferred with 1 ml of lysis buffer to a fresh Eppendorf tube. Beads were washed once with 1 ml lysis buffer and twice with 1 ml of 50 mm ammbic (pH 8.3). Beads were transferred in ammbic to a fresh centrifuge tube and washed two more times with 1 ml ammbic buffer. Tryptic digestion was performed by incubating the beads with 1 μg MS grade TPCK trypsin (Promega, Madison, WI) dissolved in 200 μl of 50 mm ammbic (pH 8.3) overnight at 37 °C. The following morning, an additional 0.5 μg trypsin was added, and the beads incubated for 2 h at 37 °C. Beads were pelleted by centrifugation at 2000 × g for 2 min, and the supernatant was transferred to a fresh Eppendorf tube. Beads were washed twice with 150 μl of 50 mm ammonium bicarbonate, and washes pooled with the eluate. The sample was lyophilized and resuspended in buffer A (0.1% formic acid). One-fifth of the sample was analyzed per MS run.

      Mass Spectrometry Analysis

      High performance liquid chromatography was conducted using a 2 cm pre-column (Acclaim PepMap 50 mm × 100 μm inner diameter (ID)) and 50 cm analytical column (Acclaim PepMap, 500 mm × 75 μm ID; C18; 2 um; 100 Å, Thermo Fisher Scientific, Waltham, MA), running a 120 min reversed-phase buffer gradient at 225 nl/min on a Proxeon EASY-nLC 1000 pump in-line with a Thermo Q-Exactive HF quadrupole-Orbitrap mass spectrometer. A parent ion scan was performed using a resolving power of 60,000, then up to the twenty most intense peaks were selected for MS/MS (minimum ion count of 1000 for activation) using higher energy collision induced dissociation (HCD) fragmentation. Dynamic exclusion was activated such that MS/MS of the same m/z (within a range of 10 ppm; exclusion list size = 500) detected twice within 5 s were excluded from analysis for 15 s. For protein identification, Thermo .RAW files were converted to the .mzXML format using ProteoWizard (v3.0.10800; 4/27/2017) (
      • Kessner D.
      • Chambers M.
      • Burke R.
      • Agus D.
      • Mallick P.
      ProteoWizard: open source software for rapid proteomics tools development.
      ). Using the Trans-Proteomic Pipeline (TPP v4.7 Polar Vortex rev 1, linux build 201705011551) converted files were searched using X!Tandem (Jackhammer TPP 2013.06.15.1) (
      • Craig R.
      • Beavis R.C.
      TANDEM: matching proteins with tandem mass spectra.
      ) and Comet (2014.02 rev. 2) (
      • Eng J.K.
      • Jahan T.A.
      • Hoopmann M.R.
      Comet: an open-source MS/MS sequence database search tool.
      ) against the Human RefSeq Version 45 database (containing 36113 entries). Search parameters specified a parent ion mass tolerance of 10 ppm, and an MS/MS fragment ion tolerance of 0.4 Da, with up to 2 missed cleavages allowed for trypsin. No fixed modifications were used. Variable modifications of [email protected] and W, [email protected] and W, [email protected] terminus, and [email protected] and Q were allowed. Proteins identified with an iProphet cut-off of 0.9 (corresponding to ≤1% FDR) and at least two unique peptides were analyzed with SAINT Express v.3.6. Control runs (16 runs for BioID; 16 runs for IP-MS; all from cells expressing the FlagBirA* epitope tag only) were collapsed to the four highest spectral counts for each prey, and high confidence interactors were defined as those with BFDR≤0.01. Each bait protein was analyzed with both an N- and C-terminal BirA* tag. Two biological replicates (i.e. separate transfections) were each subjected to two MS runs (two technical replicates). Each of the ten ZIKV bait proteins was analyzed using both BioID and Flag IP, for a total of 160 MS runs. Average R2 between technical replicates: 0.976. Average R2 between biological replicates: 0.888 (supplemental Table S1).

      Networks and Clustering Analysis

      SAINT data were imported into Cytoscape 3.4 (http://www.cytoscape.org). All network files and parameters are available at http://prohits-web.lunenfeld.ca/.

      Immunofluorescence, Image Acquisition, and Processing

      Transiently transfected HeLa cells expressing GFP- or FlagBirA*-tagged proteins were grown on coverslips, fixed with 4% paraformaldehyde for 15 min, and washed in PBS with 0.1% Triton X-100. Cells were blocked in 5% bovine serum albumin (BSA) in PBS for 30 min before incubating in the indicated primary antibodies for 1 h at RT. Primary antibodies were used at the following concentrations: anti-FLAG M2 (1:500; Sigma-Aldrich), anti-CANX C5C9 (1:50; Cell Signaling Technologies, Danvers, MA), anti-Lamin B1 (1:1000; Abcam 16048), anti-COIL (1:1000; Abcam 11822), anti-P4HB (1:1000; Stressgen, Victoria, BC, Canada, SPA-891), anti-Fibrillarin (1:100; Abcam 5821). After removing the antibody solution, cells were washed once and incubated for 1 h with anti-mouse or anti-rabbit Alexa (488, 594, or 647)-conjugated secondary antibodies. In some cases, Streptavidin-Alexa594 (1:5000, Invitrogen) or BODIPY 493/503 (1:100, Invitrogen) were added with secondary antibodies. Cells were washed twice with PBS, then with 1 μg/ml of 4′,6-diamidino-2- phenylindole (DAPI) in PBS for 5 min. After washing with PBS three more times for 5 min each, coverslips were mounted with ProLong Gold Antifade (Thermo Fischer Scientific). Cells were imaged using PlanApo 60X oil lens, NA 1.40 on an Olympus FV1000 confocal microscope (zoom factor between 3–5; Olympus America, Melville, NY). Images were processed using the Volocity Viewer v.6 and assembled using Adobe Illustrator CS6 (Adobe Systems Inc.).

      Cajal Body Quantification

      HeLa cells were transfected with the FlagBirA*-NS5 vector, incubated 24 h, then incubated an additional 24 h on coverslips with biotin (50 μm). Cells were fixed and permeabilized as above, then stained with anti-COIL and Streptavidin AF594 (as a reporter of positive FlagBirA*-NS5 cells). Cajal body (CB) volumes (red objects gated between 0.1–5 μm3) were quantified using the Volocity 6.0 measurement tool. In each experiment, CB volumes (COIL-positive nuclear bodies) were quantified in DAPI positive objects (gated between 100–500 μm3) of the NS5-positive gated population versus the NS5 low/negative gated population. Data (raw data supplemental Table S4) of 25 stitched fields for each of the two independent experiments were merged and plotted using Excel. For calculation of the number of CB/cell, three nonoverlapping fields per experiment were used, and the number of CB observed in each subpopulation was averaged according to the number of nuclei (supplemental Table S3). Student's t test was performed with Excel T.TEST function (Microsoft, Redmond, WA).

      Lysosome Quantification

      HeLa cells were transfected with the indicated GFP-tagged constructs and incubated 48 h on coverslips at 37 °C. Cultured cells were stained with 1 μg/ml of Hoechst 33342 dye (Fisher Scientific) for 15 min at 37 °C. Cells were washed twice with pre-warmed PBS, before incubating in DMEM with no pH indicator (GIBCO, Invitrogen). Lysotracker Red DND-99 (Molecular Probes, Eugene, OR) was used at 50 nm for 30 min. Coverslips were fixed with 4% paraformaldehyde for 15 min, then washed three times with PBS, and mounted. Lysosome volumes (red objects gated between 0.1–5 μm3) were quantified using the Volocity 6.0 measurement tool. Data from 16 stitched fields per condition were merged. ANOVA was performed with the FUNCRES.XLAM Excel add-in. Student's t test was performed with Excel T.TEST function (Microsoft). Graph and data distribution were assembled with Excel.

      Centriolar Satellite Microscopy

      Cells were probed with a PCM1 rabbit polyclonal antibody (A301–149A, Bethyl, Montgomery, TX) and imaged with a 60× oil-immersion objective (1.42 NA) on a Deltavision Elite DV imaging system equipped with sCMOS 2048 × 2048 pixels2 camera (GE Healthcare). Z stacks (0.2 um) were collected, deconvolved using softWoRx v5.0 (Applied Precision, Mississauga, ON, Canada) and are shown as maximum intensity projections (pixel size 0.1064 um).

      Peroxisome Microscopy

      Cells were fixed in paraformaldehyde and permeabilized with 0.1% Triton X-100 in PBS, followed by incubation with the indicated antibodies. A Zeiss LSM 710 laser-scanning confocal microscope with a 63 × 1.4 NA oil immersion objective was used to acquire fluorescence images of cells. Z-stacks series were collected for measuring cell and peroxisome volume. Volocity 5.0 software (Perkin Elmer, Waltham, MA) was used to quantify cell volume, peroxisome number (peroxisome density) and peroxisome volume. ImageJ (NIH, Bethesda) was used to adjust brightness and contrast of images.

      Immunoblotting and Co-IP

      Vero cell lysates in Laemmli buffer were analyzed by SDS-PAGE and subjected to Western blotting using: rabbit monoclonal anti-PMP70 (Abcam, Cambridge, UK), rabbit polyclonal anti-PEX14 (Millipore, Burlington, MA), mouse monoclonal anti-ATP5A (Abcam), mouse monoclonal anti-GAPDH-HRP (Novusbio, Littleton, CO), goat anti-rabbit IgG-HRP (Santa Cruz, Dallas, TX), goat anti-mouse IgG-HRP (Cedarlane, Burlington, ON, Canada). FlagBirA*-tagged protein extression was assayed by SDS-PAGE and Western blotting using: anti-FLAG M2, and biotinylated substrates visualized with Streptactin-HRP (BioRad, Hercules, CA, 1:10000 in PBS 0.1% Tween, 5% BSA). Co-IP was performed on 293 T-REx cells expressing FlagBirA*-NS3, as described in (
      • Duffy M.R.
      • Chen T.H.
      • Hancock W.T.
      • Powers A.M.
      • Kool J.L.
      • Lanciotti R.S.
      • Pretrick M.
      • Marfel M.
      • Holzbauer S.
      • Dubray C.
      • Guillaumot L.
      • Griggs A.
      • Bel M.
      • Lambert A.J.
      • Laven J.
      • Kosoy O.
      • Panella A.
      • Biggerstaff B.J.
      • Fischer M.
      • Hayes E.B.
      Zika virus outbreak on Yap Island, Federated States of Micronesia.
      ) and proteins analyzed by SDS-PAGE and Western blotting using anti-CEP85 antibody (Abnova, Taipei City, Taiwan H00064793-B01P, 1:500).

      RESULTS

      The ZIKV genome encodes a single large polyprotein, which is cleaved by viral and host cell proteases to generate ten distinct polypeptides (Fig. 1A). To better understand ZIKV-host interactions, the ten ZIKV proteins were fused in-frame with an N- or C-terminal Flag-BirA R118G tag (constructs based on ZIKV H/PF/2013 ANO46305.1 (
      • Baronti C.
      • Piorkowski G.
      • Charrel R.N.
      • Boubis L.
      • Leparc-Goffart I.
      • de Lamballerie X.
      Complete coding sequence of zika virus from a French polynesia outbreak in 2013.
      ); individual proteins based on cleavage sites reported in (
      • Kuno G.
      • Chang G.J.
      Full-length sequencing and genomic characterization of Bagaza, Kedougou, and Zika viruses.
      )) and expressed in HEK 293 cells, a system that displays characteristics of immature neurons (
      • Shaw G.
      • Morse S.
      • Ararat M.
      • Graham F.L.
      Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells.
      ) and which can be infected with ZIKV (
      • Monel B.
      • Compton A.A.
      • Bruel T.
      • Amraoui S.
      • Burlaud-Gaillard J.
      • Roy N.
      • Guivel-Benhassine F.
      • Porrot F.
      • Genin P.
      • Meertens L.
      • Sinigaglia L.
      • Jouvenet N.
      • Weil R.
      • Casartelli N.
      • Demangel C.
      • Simon-Loriere E.
      • Moris A.
      • Roingeard P.
      • Amara A.
      • Schwartz O.
      Zika virus induces massive cytoplasmic vacuolization and paraptosis-like death in infected cells.
      ) (supplemental Fig. S1A, S1B). Bait protein localization was queried using anti-Flag immunofluorescence (IF) confocal microscopy (supplemental Fig. S1C; additional IF available at ProHits-web.ca). Localizations were consistent with several previous reports on ZIKV and/or related Flaviviral proteins (supplemental Fig. S1C). Colocalization of otherwise identical N- and C-terminal-tagged ZIKV proteins indicated that the tagging moieties did not significantly affect intracellular localization (supplemental Fig. S1D).
      Figure thumbnail gr1
      Fig. 1A ZIKV-host protein topology map. A, The Zika virus (ZIKV) polyprotein. Position and individual protein length (in amino acids) are indicated. B, Self-organized prefuse force-directed topology map (based on peptide count sum of four mass spectrometry runs) for the ZIKV-host interactome. Bait proteins are represented by larger nodes, interactors represented by smaller nodes. Prey proteins previously physically or functionally linked to Flaviviruses (solid circle) or any other virus (broken circle) are indicated. Edge thickness is proportional to spectral counts. Red edge indicates an interaction detected by IP-MS, blue edge indicates those detected by BioID. C, Map positions of the indicated protein groups overlaid on a thumbnail of the topology map. D, Venn diagram depicting category breakdown of previously published virus-host interactions; functional interactions (green), physical interactions (yellow) or other (gray). E, Number of high confidence interacting partners identified by each method, as indicated (top); number of membrane proteins identified by each technique (bottom). F, Gene ontology category enrichment for BioID and IP-MS data sets. (See for full GO category analysis.)
      Using these cells, the virus-host protein interaction landscape was characterized using immunoprecipitation coupled with mass spectrometry (Flag IP-MS) and proximity-dependent biotin identification (BioID (
      • Roux K.J.
      • Kim D.I.
      • Raida M.
      • Burke B.
      A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.
      ), supplemental Table S1, supplemental Fig. S2A–S2B; searchable data set available at ProHits-web.ca; raw data available at massive.ucsd.edu, accession #MSV000082311). Using a Bayesian false discovery rate of ≤1%, 3033 high confidence interactions were identified among 1224 unique human proteins.
      To better understand the ZIKV-host interactome, a self-organized force-directed bait-prey topology map was generated, in which map location is determined by the number and abundance (i.e. total peptide counts) of host interactors (Fig. 1B). As expected, this approach closely clustered all six predicted ZIKV transmembrane proteins. This “core” map region encompasses the most highly interconnected preys (i.e. those that interact with the highest number of baits; Fig. 1C) and is enriched for nuclear, endoplasmic reticulum (ER), Golgi and other membrane polypeptides. Capsid protein (C) interactors were enriched in both membrane and nonmembrane proteins; this bait polypeptide thus occupies a distinct territory connected to, yet slightly removed from, the core. The three nonmembrane ZIKV proteins (NS1, NS3, and NS5) occupy peripheral areas of the map (Fig. 1B). These areas are enriched for e.g. DNA and RNA-associated proteins (Fig. 1C). Previously described virus protein interactors and putative novel interactors are represented throughout the map (Fig. 1C).
      Three hundred forty-seven physical or functional interactors previously implicated in Flavivirus infection, and an additional 434 interactors linked to other viruses, are represented in the ZIKV interactome (Fig. 1D; supplemental Table S1), comprising >60% of the interaction network and highlighting the quality of the data set. 738 polypeptides were detected as high confidence interactors for a single ZIKV bait protein, revealing a high degree of specificity for the viral-host interactions. Relevant to the link between ZIKV infection and fetal brain development, more than 85% of the ZIKV interacting proteins identified in HEK 293 cells are expressed in the human cerebral cortex (
      • Uhlen M.
      • Oksvold P.
      • Fagerberg L.
      • Lundberg E.
      • Jonasson K.
      • Forsberg M.
      • Zwahlen M.
      • Kampf C.
      • Wester K.
      • Hober S.
      • Wernerus H.
      • Bjorling L.
      • Ponten F.
      Towards a knowledge-based Human Protein Atlas.
      ) (supplemental Fig. S2C, supplemental Table S2).
      One hundred sixty-five proteins were detected by both BioID and IP-MS (Fig. 1E). This protein population was significantly enriched for host components localized to soluble cellular fractions (e.g. RNA binding proteins (73/165; GO:0003723) and nucleolar (54/165; GO:0005730) components) but was depleted for membrane proteins (supplemental Table S2). Only ten interactors in this group were annotated as intrinsic to intracellular membranes (GO:0031300).
      Although the two techniques identified a roughly equal number of high confidence interactors (701 versus 688 proteins identified by IP-MS and BioID, respectively), BioID identified >3x more membrane-associated polypeptides (Fig. 1E; see supplemental Table S3 for all GO annotations). Consistent with this observation, although both data sets are enriched for e.g. ubiquitin proteasome system (UPS) components, the IP-MS data set is uniquely enriched in cytoplasmic polypeptides and RNA processing proteins, whereas the BioID data set is specifically enriched for nuclear, ER and Golgi membrane proteins, cytoplasmic vesicle and lipid droplet components (Fig. 1F). Like previous reports (
      • Lambert J.P.
      • Tucholska M.
      • Go C.
      • Knight J.D.
      • Gingras A.C.
      Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.
      ,
      • Gupta G.D.
      • Coyaud E.
      • Goncalves J.
      • Mojarad B.A.
      • Liu Y.
      • Wu Q.
      • Gheiratmand L.
      • Comartin D.
      • Tkach J.M.
      • Cheung S.W.
      • Bashkurov M.
      • Hasegan M.
      • Knight J.D.
      • Lin Z.Y.
      • Schueler M.
      • Hildebrandt F.
      • Moffat J.
      • Gingras A.C.
      • Raught B.
      • Pelletier L.
      A dynamic protein interaction landscape of the human centrosome-cilium interface.
      ), our data thus suggest that IP-MS and BioID sample largely discrete protein populations and intracellular environments, and thereby identify complementary interactor sets.
      Consistent with previous CRISPR- and sh/siRNA-based screens identifying host proteins required for Flavivirus replication (
      • Savidis G.
      • McDougall W.M.
      • Meraner P.
      • Perreira J.M.
      • Portmann J.M.
      • Trincucci G.
      • John S.P.
      • Aker A.M.
      • Renzette N.
      • Robbins D.R.
      • Guo Z.
      • Green S.
      • Kowalik T.F.
      • Brass A.L.
      Identification of Zika virus and Dengue virus dependency factors using functional genomics.
      ,
      • Marceau C.D.
      • Puschnik A.S.
      • Majzoub K.
      • Ooi Y.S.
      • Brewer S.M.
      • Fuchs G.
      • Swaminathan K.
      • Mata M.A.
      • Elias J.E.
      • Sarnow P.
      • Carette J.E.
      Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.
      ,
      • Yasunaga A.
      • Hanna S.L.
      • Li J.
      • Cho H.
      • Rose P.P.
      • Spiridigliozzi A.
      • Gold B.
      • Diamond M.S.
      • Cherry S.
      Genome-wide RNAi screen identifies broadly-acting host factors that inhibit arbovirus infection.
      ,
      • Ma H.
      • Dang Y.
      • Wu Y.
      • Jia G.
      • Anaya E.
      • Zhang J.
      • Abraham S.
      • Choi J.G.
      • Shi G.
      • Qi L.
      • Manjunath N.
      • Wu H.
      A CRISPR-based screen identifies genes essential for West-Nile-virus-induced cell death.
      ,
      • Zhang R.
      • Miner J.J.
      • Gorman M.J.
      • Rausch K.
      • Ramage H.
      • White J.P.
      • Zuiani A.
      • Zhang P.
      • Fernandez E.
      • Zhang Q.
      • Dowd K.A.
      • Pierson T.C.
      • Cherry S.
      • Diamond M.S.
      A CRISPR screen defines a signal peptide processing pathway required by flaviviruses.
      ), multiple ZIKV polypeptides interact with components of the ER signal peptidase complex, ER membrane complex, glucosyltransferases and the BAT3 tail-anchored membrane protein insertion complex (Fig. 2A). This large suite of host proteins is thus likely to be required for proper ZIKV polypeptide folding, processing, post-translational modification, membrane localization and virion assembly.
      Figure thumbnail gr2
      Fig. 2Individual ZIKV proteins interact with both shared and unique subsets of host proteins linked to a variety of biological functions. A, ZIKV proteins interact extensively with the host endomembrane system. Bait proteins are represented by larger nodes, interactors represented by smaller, color-coded nodes, and grouped according to intracellular localization. Interactions detected by BioID are indicated with blue edges (dark blue detected with N-terminal tagged ZIKV bait protein, light blue detected by C-terminal tagged bait protein); interactions detected by IP-MS are indicated by red and orange edges. Prey proteins previously linked to Flavivirus function are encircled in solid gray, prey previously linked to other viruses are highlighted with a broken gray circle. B, C interacts with nucleolar proteins, nuclear and ER membrane proteins, and polypeptide components of lipid droplets. C, C colocalizes with the nucleolar marker fibrillarin. Immunofluorescence microscopy of GFP-tagged C protein and endogenous fibrillarin. All scale bars 10 μm. D, Nuclear C protein occupies DAPI-poor regions, and colocalizes with the nuclear membrane protein lamin B1. E, Nuclear C colocalizes with the ER markers P4HB, CANX and FAM134B. F, Cytoplasmic C is localized to the ER and lipid droplets.
      Individual ZIKV protein interactomes revealed targeting to host proteins with a variety of biological functions. For example, the Capsid (C) protein IP-MS identified interactions with multiple nucleolar proteins (Fig. 2B). Consistent with this observation and previous reports demonstrating that the related Dengue virus (DENV) capsid protein is localized to the nucleolus (
      • Balinsky C.A.
      • Schmeisser H.
      • Ganesan S.
      • Singh K.
      • Pierson T.C.
      • Zoon K.C.
      Nucleolin interacts with the dengue virus capsid protein and plays a role in formation of infectious virus particles.
      ), IF confocal microscopy of ZIKV C-expressing cells revealed colocalization with the nucleolar marker fibrillarin (Fig. 2C). BioID identified C proximity interactions at the nuclear, ER and other membranes (Fig. 2B). C is also localized to DAPI-poor nuclear structures not associated with fibrillarin, and which are not observed in cells expressing other ZIKV proteins (Fig. 2D, supplemental Fig. S1C). These structures were also detected by antibodies directed against lamin B1, suggesting that they are derived (at least in part) from the nuclear membrane. Surprisingly, these structures were also detected by antibodies directed against the ER markers prolyl 4-hydroxylase subunit B (P4HB) and calnexin (CANX; Fig. 2E). Consistent with this observation, when Flag-FAM134B (a C-interacting protein required for ER-specific autophagy (
      • Khaminets A.
      • Heinrich T.
      • Mari M.
      • Grumati P.
      • Huebner A.K.
      • Akutsu M.
      • Liebmann L.
      • Stolz A.
      • Nietzsche S.
      • Koch N.
      • Mauthe M.
      • Katona I.
      • Qualmann B.
      • Weis J.
      • Reggiori F.
      • Kurth I.
      • Hubner C.A.
      • Dikic I.
      Regulation of endoplasmic reticulum turnover by selective autophagy.
      ) and which inhibits ZIKV replication (
      • Lennemann N.J.
      • Coyne C.B.
      Dengue and Zika viruses subvert reticulophagy by NS2B3-mediated cleavage of FAM134B.
      )) was coexpressed with GFP-Capsid protein, it was also recruited to these nuclear structures (Fig. 2E). Like other Flaviviruses, ZIKV extensively remodels the host endomembrane system to create viral replication factories (
      • Bell T.M.
      • Field E.J.
      • Narang H.K.
      Zika virus infection of the central nervous system of mice.
      ). Although additional study will be required to better understand these C-associated structures, our observations are consistent with previous reports (e.g. (
      • Rossignol E.D.
      • Peters K.N.
      • Connor J.H.
      • Bullitt E.
      Zika virus induced cellular remodeling.
      )) suggesting that ZIKV promotes the inward budding of host membranes.
      In the cytoplasm, C is localized to the ER and vesicular structures (Fig. 2F). The C interactome includes several proteins associated with lipid storage and metabolism (Fig. 2B) and, consistent with previous work demonstrating that both DENV and Hepatitis C virus capsid proteins localize to the surface of lipid droplets (
      • Samsa M.M.
      • Mondotte J.A.
      • Iglesias N.G.
      • Assuncao-Miranda I.
      • Barbosa-Lima G.
      • Da Poian A.T.
      • Bozza P.T.
      • Gamarnik A.V.
      Dengue virus capsid protein usurps lipid droplets for viral particle formation.
      ), cytoplasmic ZIKV C colocalizes with the lipid droplet marker Bodipy 493/503 (Fig. 2F). Together, these findings reveal multiple putative roles for C in remodeling host cell membranes and highlight the advantages of using both IP-MS and BioID for a more complete characterization of protein-protein interactions.
      The other ZIKV proteins are targeted to a number of additional host cell systems and organelles. For example, consistent with a recent report (
      • Grant A.
      • Ponia S.S.
      • Tripathi S.
      • Balasubramaniam V.
      • Miorin L.
      • Sourisseau M.
      • Schwarz M.C.
      • Sanchez-Seco M.P.
      • Evans M.J.
      • Best S.M.
      • Garcia-Sastre A.
      Zika virus targets human STAT2 to inhibit type I interferon signaling.
      ), our Flag IP-MS links ZIKV NS5 to the STAT2 signaling protein (supplemental Table S1) as well as DDA1, DDB1 and VPRBP/DCAF1 (Fig. 3A), components of a host cell ubiquitin E3 ligase previously linked to several other viruses (
      • Barry M.
      • Fruh K.
      Viral modulators of cullin RING ubiquitin ligases: culling the host defense.
      ). IP-MS conducted on both DDB1 and VPRBP/DCAF1 in the presence of NS5 validated these interactions for the ZIKV NS5 protein (Fig. 3A, supplemental Table S4).
      Figure thumbnail gr3
      Fig. 3ZIKV proteins display physical and functional links with many important host cell protein complexes and multiple host organelles. A, ZIKV NS5 interacts with the ubiquitin E3 ligase components DDA1, DDB1 and VPRBP/DCAF1. Reciprocal BioID conducted with both DDB1 and VPRBP/DCAF1 (in cells expressing NS5) validated these interactions. B, ZIKV NS5 and the Cajal Body protein coilin (COIL) share a large number of interacting partners. BioID of COIL (in cells expressing NS5) validated this interaction. C, NS5, and (D) biotinylated proteins in NS5-expressing cells, colocalize with COIL. E, Cells expressing NS5 display a significant decrease in average CB volume (black bars; ***p < 0.001) and an increase in the number of CB per cell (blue bars; **p < 0.01). F, ZIKV NS3 interacts with host proteins linked to vesicle transport, lysosome maturation and the UPS. G, Lysosome volume is significantly decreased (***p < 0.001) in cells expressing both NS3 and its cofactor NS2B. H, NS3 interacts with proteins linked to the centrosome and primary cilia. OFD1 BioID validates the interaction with NS3. I, (top) FlagBirA*-NS3 coIPs the endogenous CEP85 protein. (bottom) NS3, and biotinylated proteins in NS3-expressing cells (Strepta AF594), colocalize with the centrosome marker pericentrin (PCNT). J, NS3 is localized to the midbody in dividing cells. K, (left) Centriolar satellite clusters were counted at day 0 and day 3 post ZIKV-infection. ZIKV-infected Vero cells were probed with antibodies directed against the centriolar satellite marker PCM1 and ZIKV. (right) Cell proprtion displaying clustered centriolar satellites was quantified in uninfected and ZIKV-infected (day 3) Vero cells.
      NS5 BioID also identified components of the Cajal Body (CB; Fig. 3B), a nuclear organelle with crucial roles in spliceosomal snRNP maturation (
      • Machyna M.
      • Heyn P.
      • Neugebauer K.M.
      Cajal bodies: where form meets function.
      ). The influenza A virus nucleoprotein is also localized to CBs (
      • Hofer C.T.
      • Jolmes F.
      • Haralampiev I.
      • Veit M.
      • Herrmann A.
      Influenza A virus nucleoprotein targets subnuclear structures.
      ) but little is known regarding the role of this organelle in the Flavivirus life cycle. Consistent with our data, both NS5 (but no other ZIKV proteins; Fig. 3C, supplemental Fig. S3) and biotinylated proteins in NS5-expressing cells (Fig. 3D) colocalize with the CB marker coilin. BioID conducted on coilin in the presence and absence of NS5 (Fig. 3B, supplemental Table S5) validated this interaction. Notably, NS5 expression was also uniquely associated with significantly increased numbers of CB/cell, accompanied by a significant decrease in CB volume (Fig. 3E, supplemental Table S6). NS5 thus appears to disrupt CBs.
      NS3 BioID identified e.g. the Vaccinia restriction factor WDR6 (
      • Sivan G.
      • Ormanoglu P.
      • Buehler E.C.
      • Martin S.E.
      • Moss B.
      Identification of restriction factors by human genome-wide RNA interference screening of viral host range mutants exemplified by discovery of SAMD9 and WDR6 as inhibitors of the Vaccinia virus K1L-C7L- mutant.
      ) and the HIV1 dependence factor HELZ (
      • Cleret-Buhot A.
      • Zhang Y.
      • Planas D.
      • Goulet J.P.
      • Monteiro P.
      • Gosselin A.
      • Wacleche V.S.
      • Tremblay C.L.
      • Jenabian M.A.
      • Routy J.P.
      • El-Far M.
      • Chomont N.
      • Haddad E.K.
      • Sekaly R.P.
      • Ancuta P.
      Identification of novel HIV-1 dependency factors in primary CCR4(+)CCR6(+)Th17 cells via a genome-wide transcriptional approach.
      ) as interacting partners. NS3 IP-MS identified the DENV host factor FASTKD5 (
      • Sessions O.M.
      • Barrows N.J.
      • Souza-Neto J.A.
      • Robinson T.J.
      • Hershey C.L.
      • Rodgers M.A.
      • Ramirez J.L.
      • Dimopoulos G.
      • Yang P.L.
      • Pearson J.L.
      • Garcia-Blanco M.A.
      Discovery of insect and human dengue virus host factors.
      ) and UPS components previously linked to West Nile virus replication (
      • Krishnan M.N.
      • Ng A.
      • Sukumaran B.
      • Gilfoy F.D.
      • Uchil P.D.
      • Sultana H.
      • Brass A.L.
      • Adametz R.
      • Tsui M.
      • Qian F.
      • Montgomery R.R.
      • Lev S.
      • Mason P.W.
      • Koski R.A.
      • Elledge S.J.
      • Xavier R.J.
      • Agaisse H.
      • Fikrig E.
      RNA interference screen for human genes associated with West Nile virus infection.
      ). NS3 IP-MS also identified VPS33A, VPS18 and VPS16, core components of the HOPS/CORVET vesicle tethering complexes (Fig. 3F) required for endosome-lysosome fusion (
      • Balderhaar H.J.
      • Ungermann C.
      CORVET and HOPS tethering complexes - coordinators of endosome and lysosome fusion.
      ). Although no previous link with Flaviviruses has been reported, a genome-wide screen identified the HOPS complex as an Ebola restriction factor (
      • Carette J.E.
      • Raaben M.
      • Wong A.C.
      • Herbert A.S.
      • Obernosterer G.
      • Mulherkar N.
      • Kuehne A.I.
      • Kranzusch P.J.
      • Griffin A.M.
      • Ruthel G.
      • Dal Cin P.
      • Dye J.M.
      • Whelan S.P.
      • Chandran K.
      • Brummelkamp T.R.
      Ebola virus entry requires the cholesterol transporter Niemann-Pick C1.
      ). Notably, consistent with the NS3-HOPS/CORVET interaction, cells expressing both NS3 and its cofactor NS2B (
      • Lei J.
      • Hansen G.
      • Nitsche C.
      • Klein C.D.
      • Zhang L.
      • Hilgenfeld R.
      Crystal structure of Zika virus NS2B-NS3 protease in complex with a boronate inhibitor.
      ) exhibited significantly smaller lysosomes (Fig. 3G, supplemental Table S7), suggesting that the NS3-NS2B protease complex could disrupt lysosome function.
      ZIKV infection has been linked to significant defects in centrosome function (
      • Gabriel E.
      • Ramani A.
      • Karow U.
      • Gottardo M.
      • Natarajan K.
      • Gooi L.M.
      • Goranci-Buzhala G.
      • Krut O.
      • Peters F.
      • Nikolic M.
      • Kuivanen S.
      • Korhonen E.
      • Smura T.
      • Vapalahti O.
      • Papantonis A.
      • Schmidt-Chanasit J.
      • Riparbelli M.
      • Callaini G.
      • Kronke M.
      • Utermohlen O.
      • Gopalakrishnan J.
      Recent Zika virus isolates induce premature differentiation of neural progenitors in human brain organoids.
      ,
      • Wolf B.
      • Diop F.
      • Ferraris P.
      • Wichit S.
      • Busso C.
      • Misse D.
      • Gonczy P.
      Zika virus causes supernumerary foci with centriolar proteins and impaired spindle positioning.
      ). Consistent with these observations, our data reveal ZIKV polypeptide interactions with multiple centrosome and cilia regulatory proteins. For example, NS3 (Fig. 3H) interacts with UNC119B, a myristoyl chaperone required for recruiting NPHP (nephronophthisis) proteins to cilia (
      • Zhang Q.
      • Li Y.
      • Zhang Y.
      • Torres V.E.
      • Harris P.C.
      • Ling K.
      • Hu J.
      GTP-binding of ARL-3 is activated by ARL-13 as a GEF and stabilized by UNC-119.
      ); CEP192, a major regulator of centrosome and spindle assembly; OFD1, a centrosome/centriolar satellite protein (
      • Macca M.
      • Franco B.
      The molecular basis of oral-facial-digital syndrome, type 1.
      ); and CEP85, a protein linked to centrosome biogenesis (
      • Tsuchiya Y.
      • Yoshiba S.
      • Gupta A.
      • Watanabe K.
      • Kitagawa D.
      Cep295 is a conserved scaffold protein required for generation of a bona fide mother centriole.
      ,
      • Chen C.
      • Tian F.
      • Lu L.
      • Wang Y.
      • Xiao Z.
      • Yu C.
      • Yu X.
      Characterization of Cep85 - a new antagonist of Nek2A that is involved in the regulation of centrosome disjunction.
      ). The NS3-OFD1 interaction was validated via BioID (Fig. 3H, supplemental Table S8) and the NS3-CEP85 interaction was confirmed by co-IP western (Fig. 3I). Consistent with these data, NS3 and its biotinylated proximity partners colocalize with pericentrin (PCNT), a component of the pericentriolar material (Fig. 3I). NS3 also localized to the abscission sites of dividing cells, suggesting an interaction with shared components of the centrosome and midbody (Fig. 3J). Although no gross defects were observed for primary cilia or centrosomes in ZIKV-infected Vero cells (data not shown), structured illumination microscopy revealed large-scale disruption of centriolar satellite clusters (Fig. 3K), consistent with disruption of centrosome function by ZIKV.
      The peroxisome has important antiviral functions, and proteins from multiple viral classes localize to this organelle (
      • Odendall C.
      • Kagan J.C.
      Peroxisomes and the antiviral responses of mammalian cells.
      ). Lipids synthesized exclusively in peroxisomes also appear to be required for viral replication: e.g. decreased peroxisome-specific ether lipid synthesis impairs influenza virus replication (
      • Tanner L.B.
      • Chng C.
      • Guan X.L.
      • Lei Z.
      • Rozen S.G.
      • Wenk M.R.
      Lipidomics identifies a requirement for peroxisomal function during influenza virus replication.
      ). Consistent with these studies, our data revealed extensive ZIKV protein interactions with peroxisome-associated polypeptides (Fig. 4A). For example, several ZIKV proteins established high confidence interactions with the peroxisomal membrane protein ABCD3/PMP70; ACBD5, VAPA and VAPB, a set of ER-peroxisome membrane contact site proteins required for lipid transfer (
      • Hua R.
      • Cheng D.
      • Freeman S.
      • Di Pietro E.
      • Coyaud E.
      • Wang Y.
      • Vissa A.
      • Demers N.
      • Yip C.M.
      • Fairn G.D.
      • Braverman N.
      • Brumell J.
      • Trimble W.
      • Raught B.
      • Kim P.K.
      VAPs and ACBD5 tether peroxisomes to the ER for peroxisome maintenance and lipid homeostasis.
      ,
      • Costello J.L.
      • Castro I.G.
      • Hacker C.
      • Schrader T.A.
      • Metz J.
      • Zeuschner D.
      • Azadi A.S.
      • Godinho L.F.
      • Costina V.
      • Findeisen P.
      • Manner A.
      • Islinger M.
      • Schrader M.
      ACBD5 and VAPB mediate membrane associations between peroxisomes and the ER.
      ); and the peroxisome biogenesis protein PEX11B. ZIKV NS2A uniquely interacts with both components of the peroxisome protein import complex, PEX3 and PEX19 (Fig. 4A). Consistent with these data, GFP-NS2A (but no other ZIKV proteins) localizes to peroxisomes (Fig. 4B, supplemental Fig. S4). To begin to explore the role of the peroxisome in ZIKV biology, GFP-NS2A was expressed in a wild type (wt) human skin fibroblast cell line and fibroblast lines derived from Zellweger syndrome patients deficient for PEX19 (PBD399 (
      • Sacksteder K.A.
      • Jones J.M.
      • South S.T.
      • Li X.
      • Liu Y.
      • Gould S.J.
      PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis.
      )) or PEX3 (PBD400 (
      • South S.T.
      • Sacksteder K.A.
      • Li X.
      • Liu Y.
      • Gould S.J.
      Inhibitors of COPI and COPII do not block PEX3-mediated peroxisome synthesis.
      )) and thus lacking functional peroxisomes. As expected, GFP-NS2A colocalized with peroxisomes in wt fibroblasts (Fig. 4C). Notably, however, it was mislocalized to the cytoplasm in both PBD399 and PBD400 cells, suggesting that NS2A is specifically targeted to peroxisomes (Fig. 4C).
      Figure thumbnail gr4
      Fig. 4Peroxisomes are required for efficient ZIKV infection. A, Multiple ZIKV proteins interact with peroxisome and/or peroxisomal regulatory polypeptides. B, GFP-NS2A colocalizes with the peroxisome protein ABCD3/PMP70. C, GFP-NS2A expressed in wild type (WT) human fibroblasts localizes to peroxisomes but is mislocalized to the cytoplasm in PBD399 and PBD400 peroxisome-free cells. D, (top) Whole cell lysates from ZIKV-infected Vero cells were subjected to Western blotting, using antibodies directed against the indicated proteins. Quantitation of results (bottom) presented as bar graphs; *p < 0.05. E, Uninfected (Day 0) and ZIKV-infected Vero cells (3d post-infection), coimmunostained for ZIKV and PMP70. F, Quantitation of peroxisome density (peroxisomes/cell volume) in cells expressing GFP-NS2A *p < 0.05 or; G, infected with ZIKV; **p < 0.01. H, Viral titers (at indicated times post-ZIKV infection) were measured in the indicated cell lines (GM5756, wild type human fibroblasts); *p < 0.05; **p < 0.01.
      ABCD3/PMP70 is significantly decreased in response to ZIKV infection (as compared with control proteins GAPDH and ATP5A; Fig. 4D). Consistent with this observation, significant decreases in peroxisome density (peroxisomes/unit cell volume) were also observed in cells expressing GFP-NS2A (Fig. 4F, supplemental Table S9) and in ZIKV-infected cells (Fig. 4E, 4G, supplemental Table S10). Finally, consistent with an important role for the peroxisome in ZIKV biology, ZIKV yields were significantly lower in Zellweger fibroblasts than in WT cells (Fig. 4H).

      DISCUSSION

      Together, our global ZIKV interactome identifies >1200 putative host interacting protein partners, physically linking the ten individual viral proteins to specific human polypeptides, and revealing a broad array of putative accessory functions for both the structural and nonstructural Zika polypeptides in the virus life cycle (Fig. 5; for detailed enrichment analysis, see supplemental Table S2). For example, the NS3 protease has been linked to ZIKV polyprotein cleavage and is essential for virus replication (
      • Luo D.
      • Vasudevan S.G.
      • Lescar J.
      The flavivirus NS2B-NS3 protease-helicase as a target for antiviral drug development.
      ). Our data suggest that coexpression of NS3 and its cofactor NS2B can also impact lysosome function. Interactions between NS3 and three components of the HOPS/CORVET complex suggest that the decreased lysosome volume observed specifically in response to the coexpression of NS2B and NS3 could be because of a defect in late endosome-lysosome fusion, potentially supporting virus-containing endosome escape from lysosomal degradation and clearance. Our analysis also revealed a clear association of NS4A, NS4B and PreM with the 26S proteasome. Although these interactions remain to be investigated in an infectious context, the data suggest a putative role for this set of ZIKV proteins in e.g. blocking viral protein degradation, or the targeted degradation of host innate immune response proteins. As expected, C, PreM and Env were localized to the ER, where virus factories are created and viral particles assembled (
      • Blazevic J.
      • Rouha H.
      • Bradt V.
      • Heinz F.X.
      • Stiasny K.
      Membrane anchors of the structural flavivirus proteins and their role in virus assembly.
      ). We also detected NS2A, NS2B, NS4A, and NS4B at this organelle. These four nonstructural proteins are also likely to be involved in the formation of virus-induced membrane structures at the ER, by homology with West Nile Virus proteins (
      • Kaufusi P.H.
      • Kelley J.F.
      • Yanagihara R.
      • Nerurkar V.R.
      Induction of endoplasmic reticulum-derived replication-competent membrane structures by West Nile virus non-structural protein 4B.
      ). NS2A and NS2B are also likely to play roles in vRNA replication, as reported for the homologous proteins in the Japanese encephalitis virus (
      • Li X.D.
      • Deng C.L.
      • Ye H.Q.
      • Zhang H.L.
      • Zhang Q.Y.
      • Chen D.D.
      • Zhang P.T.
      • Shi P.Y.
      • Yuan Z.M.
      • Zhang B.
      Transmembrane domains of NS2B contribute to both viral RNA replication and particle formation in Japanese encephalitis virus.
      ).
      Figure thumbnail gr5
      Fig. 5ZIKV protein localization and potential links to the ZIKV life cycle. (
      • Petersen L.R.
      • Jamieson D.J.
      • Powers A.M.
      • Honein M.A.
      Zika Virus.
      ) The NS3-NS2B protease interacts with HOPS/CORVET complex components, accompanied by an apparent inhibition of late endosome-lysosome fusion. NS3-NS2B function could thus be important to protect endosomal ZIKV from lysosome-mediated degradation; (
      • Chen H.L.
      • Tang R.B.
      Why Zika virus infection has become a public health concern?.
      ) PreM, NS4A and NS4B are associated with the 26S proteasome. This host cell complex is commonly highjacked by viruses for e.g. innate immune system evasion; (
      • Dick G.W.
      • Kitchen S.F.
      • Haddow A.J.
      Zika virus. I. Isolations and serological specificity.
      ) multiple ZIKV proteins localize to the ER, consistent with roles in viral factory formation and viral replication; (
      • Duffy M.R.
      • Chen T.H.
      • Hancock W.T.
      • Powers A.M.
      • Kool J.L.
      • Lanciotti R.S.
      • Pretrick M.
      • Marfel M.
      • Holzbauer S.
      • Dubray C.
      • Guillaumot L.
      • Griggs A.
      • Bel M.
      • Lambert A.J.
      • Laven J.
      • Kosoy O.
      • Panella A.
      • Biggerstaff B.J.
      • Fischer M.
      • Hayes E.B.
      Zika virus outbreak on Yap Island, Federated States of Micronesia.
      ) like other Flaviviruses, the ZIKV capsid protein is addressed to lipid droplets, where it could e.g. highjack host-cell lipid metabolism for viral replication; (
      • Cao-Lormeau V.M.
      • Roche C.
      • Teissier A.
      • Robin E.
      • Berry A.L.
      • Mallet H.P.
      • Sall A.A.
      • Musso D.
      Zika virus, French polynesia, South pacific, 2013.
      ) NS2A is uniquely localized to peroxisomes, and negatively impacts peroxisome density; (
      • Zanluca C.
      • Melo V.C.
      • Mosimann A.L.
      • Santos G.I.
      • Santos C.N.
      • Luz K.
      First report of autochthonous transmission of Zika virus in Brazil.
      ) NS5 is localized to and appears to disrupt Cajal bodies, possibly to impair host cell splicing or usurp CB activities for viral RNA maturation; (
      • Campos G.S.
      • Bandeira A.C.
      • Sardi S.I.
      Zika Virus Outbreak, Bahia, Brazil.
      ) ZIKV capsid protein-induced inward nuclear/ER membrane budding is likely important for the creation of viral factories; (
      • Poland G.A.
      • Kennedy R.B.
      • Ovsyannikova I.G.
      • Palacios R.
      • Ho P.L.
      • Kalil J.
      Development of vaccines against Zika virus.
      ) Deficiencies in centrosomal proteins, including centriolar satellite components, are responsible for congenital microcephalies. ZIKV infection results in the dispersion of centriolar satellites, possibly explaining the surge in microcephaly cases associated with infected human populations.
      The BioID approach revealed a number of associations between specific Zika polypeptides and host-cell lipid metabolism machinery, which is significantly reprogrammed upon Flaviviral infection (reviewed in (
      • Martin-Acebes M.A.
      • Vazquez-Calvo A.
      • Saiz J.C.
      Lipids and flaviviruses, present and future perspectives for the control of dengue, Zika, and West Nile viruses.
      )). Like the DENV capsid polypeptide (
      • Samsa M.M.
      • Mondotte J.A.
      • Iglesias N.G.
      • Assuncao-Miranda I.
      • Barbosa-Lima G.
      • Da Poian A.T.
      • Bozza P.T.
      • Gamarnik A.V.
      Dengue virus capsid protein usurps lipid droplets for viral particle formation.
      ), the ZIKV Capsid protein was also detected at lipid droplets, where it could highjack host-cell lipid metabolism for viral replication. We also found that ZIKV NS2A is uniquely targeted to peroxisomes, an organelle that plays a critical role in lipid processing, and which acts as an important innate immune response signaling platform (
      • Odendall C.
      • Kagan J.C.
      Peroxisomes and the antiviral responses of mammalian cells.
      ,
      • Tanner L.B.
      • Chng C.
      • Guan X.L.
      • Lei Z.
      • Rozen S.G.
      • Wenk M.R.
      Lipidomics identifies a requirement for peroxisomal function during influenza virus replication.
      ). ZIKV infection or expression of NS2A alone decreased peroxisome density (organelle number/cell volume) in host cells, and ZIKV replication was significantly impaired in peroxisome-deficient cells. Together, these data suggest that NS2A targets peroxisomes to remodel host-cell lipid populations and/or to effect viral escape from the host innate immune response (as previously shown for DENV and WNV (
      • You J.
      • Hou S.
      • Malik-Soni N.
      • Xu Z.
      • Kumar A.
      • Rachubinski R.A.
      • Frappier L.
      • Hobman T.C.
      Flavivirus infection impairs peroxisome biogenesis and early antiviral signaling.
      )).
      We also detected many interactors involved in DNA and RNA metabolism. For example, ZIKV NS5 interacts with coilin, a major component of the Cajal Body (CB), a nuclear membrane-free organelle required for spliceosome maturation. We speculate that the ability of NS5 to fragment CBs could impair the processing of host-cell mRNAs, and thereby increase the availability of host ribosomes for viral RNA translation, and/or ZIKV NS5 could be important for usurping CB activities required for vRNA maturation.
      Notably, expression of the C protein alone induced the inward budding of nuclear/ER membranes into the nucleoplasm. The ability of C to interact with both host endomembranes and RNAs has been well documented, properties that are critical for vRNA encapsidation in Flavivirus virions (reviewed in (
      • Oliveira E.R.A.
      • Mohana-Borges R.
      • de Alencastro R.B.
      • Horta B.A.C.
      The flavivirus capsid protein: Structure, function and perspectives towards drug design.
      )). Its positively charged carboxy-terminal domain makes it very efficient at interacting with RNAs, and we hypothesize that it could sequester host mRNAs in the nucleus to promote vRNA translation. Consistent with a previous report (
      • Hou W.
      • Cruz-Cosme R.
      • Armstrong N.
      • Obwolo L.A.
      • Wen F.
      • Hu W.
      • Luo M.H.
      • Tang Q.
      Molecular cloning and characterization of the genes encoding the proteins of Zika virus.
      ), a subpopulation of the ZIKV capsid protein is localized to the nucleolus. Capsid nucleolar localization has been documented for other Flaviviruses (
      • Wang S.H.
      • Syu W.J.
      • Huang K.J.
      • Lei H.Y.
      • Yao C.W.
      • King C.C.
      • Hu S.T.
      Intracellular localization and determination of a nuclear localization signal of the core protein of dengue virus.
      ), but the function of the viral protein in this host organelle remains unclear. Addressing the capsid protein to nucleoli could be important for maintaining host ribosomal RNA production during infection, and thus preserving functional host cell translation machinery. Finally, we report that ZIKV infection is accompanied by centriolar satellite dissolution. Deficiencies in several different centrosomal proteins, including satellite components (
      • Kodani A.
      • Yu T.W.
      • Johnson J.R.
      • Jayaraman D.
      • Johnson T.L.
      • Al-Gazali L.
      • Sztriha L.
      • Partlow J.N.
      • Kim H.
      • Krup A.L.
      • Dammermann A.
      • Krogan N.J.
      • Walsh C.A.
      • Reiter J.F.
      Centriolar satellites assemble centrosomal microcephaly proteins to recruit CDK2 and promote centriole duplication.
      ), have been linked to congenital microcephalies (
      • Chavali P.L.
      • Putz M.
      • Gergely F.
      Small organelle, big responsibility: the role of centrosomes in development and disease.
      ). Together with the specific interactions we report between ZIKV NS3 and multiple centrosome components (e.g. CEP192, CEP85, OFD1), this observation could help to explain the surge in microcephaly cases observed in infected human populations. The relationship between NS3 and centriolar satellites will be important to investigate.
      It is important to note that the current data set: (1) does not include interactions between viral proteins; (2) describes interactions that occur under relatively high ZIKV protein expression levels, and; (3) likely lacks some virus-host protein interactions that can only be observed in the context of a viral infection. Nevertheless, our data highlight the astounding versatility of ZIKV polypeptides to simultaneously target numerous host cell organelles and provide important molecular insights into how ZIKV proteins could usurp and manipulate the host-cell machinery to the benefit of the virus. As we demonstrate here, this data set represents a rich resource that can be mined to better understand how ZIKV exploits and/or disrupts specific host cell systems and organelles, and thus paves the way for a better understanding of ZIKV biology and the identification of new antiviral targets.

      DATA AVAILABILITY

      All raw mass spectrometry data have been deposited at MassIVE (massive.ucsd.edu, accession #MSV000082311). Interaction data and all supplemental materials are available at ProHits-web.lunenfeld.ca Zika interactome project.

      Acknowledgments

      We thank A. Sinha and A. Astori for outstanding technical assistance. A.-C.G. holds the Lea Reichmann chair in Cancer Proteomics and the Canada Research Chair (CRC) in Functional Proteomics.

      Supplementary Material

      REFERENCES

        • Petersen L.R.
        • Jamieson D.J.
        • Powers A.M.
        • Honein M.A.
        Zika Virus.
        N. Engl. J. Med. 2016; 374: 1552-1563
        • Chen H.L.
        • Tang R.B.
        Why Zika virus infection has become a public health concern?.
        J. Chin. Med. Assoc. 2016; 79: 174-178
        • Dick G.W.
        • Kitchen S.F.
        • Haddow A.J.
        Zika virus. I. Isolations and serological specificity.
        Trans. R. Soc. Trop. Med. Hyg. 1952; 46: 509-520
        • Duffy M.R.
        • Chen T.H.
        • Hancock W.T.
        • Powers A.M.
        • Kool J.L.
        • Lanciotti R.S.
        • Pretrick M.
        • Marfel M.
        • Holzbauer S.
        • Dubray C.
        • Guillaumot L.
        • Griggs A.
        • Bel M.
        • Lambert A.J.
        • Laven J.
        • Kosoy O.
        • Panella A.
        • Biggerstaff B.J.
        • Fischer M.
        • Hayes E.B.
        Zika virus outbreak on Yap Island, Federated States of Micronesia.
        N. Engl. J. Med. 2009; 360: 2536-2543
        • Cao-Lormeau V.M.
        • Roche C.
        • Teissier A.
        • Robin E.
        • Berry A.L.
        • Mallet H.P.
        • Sall A.A.
        • Musso D.
        Zika virus, French polynesia, South pacific, 2013.
        Emerg. Infect. Dis. 2014; 20: 1085-1086
        • Zanluca C.
        • Melo V.C.
        • Mosimann A.L.
        • Santos G.I.
        • Santos C.N.
        • Luz K.
        First report of autochthonous transmission of Zika virus in Brazil.
        Mem. Inst. Oswaldo Cruz. 2015; 110: 569-572
        • Campos G.S.
        • Bandeira A.C.
        • Sardi S.I.
        Zika Virus Outbreak, Bahia, Brazil.
        Emerg. Infect. Dis. 2015; 21: 1885-1886
        • Poland G.A.
        • Kennedy R.B.
        • Ovsyannikova I.G.
        • Palacios R.
        • Ho P.L.
        • Kalil J.
        Development of vaccines against Zika virus.
        Lancet Infect Dis. 2018; 18: e211-e219
        • Tang H.
        • Hammack C.
        • Ogden S.C.
        • Wen Z.
        • Qian X.
        • Li Y.
        • Yao B.
        • Shin J.
        • Zhang F.
        • Lee E.M.
        • Christian K.M.
        • Didier R.A.
        • Jin P.
        • Song H.
        • Ming G.L.
        Zika virus infects human cortical neural progenitors and attenuates their growth.
        Cell Stem Cell. 2016; 18: 587-590
        • Lin M.Y.
        • Wang Y.L.
        • Wu W.L.
        • Wolseley V.
        • Tsai M.T.
        • Radic V.
        • Thornton M.E.
        • Grubbs B.H.
        • Chow R.H.
        • Huang I.C.
        Zika virus infects intermediate progenitor cells and post-mitotic committed neurons in human fetal brain tissues.
        Sci. Rep. 2017; 7: 14883
        • Gatherer D.
        • Kohl A.
        Zika virus: a previously slow pandemic spreads rapidly through the Americas.
        J. Gen. Virol. 2016; 97: 269-273
        • Blazquez A.B.
        • Saiz J.C.
        Neurological manifestations of Zika virus infection.
        World J. Virol. 2016; 5: 135-143
        • Li C.
        • Xu D.
        • Ye Q.
        • Hong S.
        • Jiang Y.
        • Liu X.
        • Zhang N.
        • Shi L.
        • Qin C.F.
        • Xu Z.
        Zika virus disrupts neural progenitor development and leads to microcephaly in mice.
        Cell Stem Cell. 2016; 19: 120-126
        • Devhare P.
        • Meyer K.
        • Steele R.
        • Ray R.B.
        • Ray R.
        Zika virus infection dysregulates human neural stem cell growth and inhibits differentiation into neuroprogenitor cells.
        Cell Death Dis. 2017; 8: e3106
        • Mlakar J.
        • Korva M.
        • Tul N.
        • Popovic M.
        • Poljsak-Prijatelj M.
        • Mraz J.
        • Kolenc M.
        • Resman Rus K.
        • Vesnaver Vipotnik T.
        • Fabjan Vodusek V.
        • Vizjak A.
        • Pizem J.
        • Petrovec M.
        • Avsic Zupanc T.
        Zika virus associated with microcephaly.
        N. Engl. J. Med. 2016; 374: 951-958
        • Merfeld E.
        • Ben-Avi L.
        • Kennon M.
        • Cerveny K.L.
        Potential mechanisms of Zika-linked microcephaly.
        Wiley Interdiscip. Rev. Dev. Biol. 2017; 6: e273
        • Perera-Lecoin M.
        • Meertens L.
        • Carnec X.
        • Amara A.
        Flavivirus entry receptors: an update.
        Viruses. 2013; 6: 69-88
        • Kuno G.
        • Chang G.J.
        Full-length sequencing and genomic characterization of Bagaza, Kedougou, and Zika viruses.
        Arch. Virol. 2007; 152: 687-696
        • Shankar A.
        • Patil A.A.
        • Skariyachan S.
        Recent perspectives on genome, transmission, clinical manifestation, diagnosis, therapeutic strategies, vaccine developments, and challenges of Zika virus research.
        Front. Microbiol. 2017; 8: 1761
        • Wang A.
        • Thurmond S.
        • Islas L.
        • Hui K.
        • Hai R.
        Zika virus genome biology and molecular pathogenesis.
        Emerg. Microbes Infect. 2017; 6: e13
        • Savidis G.
        • McDougall W.M.
        • Meraner P.
        • Perreira J.M.
        • Portmann J.M.
        • Trincucci G.
        • John S.P.
        • Aker A.M.
        • Renzette N.
        • Robbins D.R.
        • Guo Z.
        • Green S.
        • Kowalik T.F.
        • Brass A.L.
        Identification of Zika virus and Dengue virus dependency factors using functional genomics.
        Cell Rep. 2016; 16: 232-246
        • Marceau C.D.
        • Puschnik A.S.
        • Majzoub K.
        • Ooi Y.S.
        • Brewer S.M.
        • Fuchs G.
        • Swaminathan K.
        • Mata M.A.
        • Elias J.E.
        • Sarnow P.
        • Carette J.E.
        Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens.
        Nature. 2016; 535: 159-163
        • Yasunaga A.
        • Hanna S.L.
        • Li J.
        • Cho H.
        • Rose P.P.
        • Spiridigliozzi A.
        • Gold B.
        • Diamond M.S.
        • Cherry S.
        Genome-wide RNAi screen identifies broadly-acting host factors that inhibit arbovirus infection.
        PLoS Pathog. 2014; 10: e1003914
        • Coyaud E.
        • Mis M.
        • Laurent E.M.
        • Dunham W.H.
        • Couzens A.L.
        • Robitaille M.
        • Gingras A.C.
        • Angers S.
        • Raught B.
        BioID-based identification of Skp Cullin F-box (SCF)beta-TrCP1/2 E3 ligase substrates.
        Mol. Cell. Proteomics. 2015; 14: 1781-1795
        • Kessner D.
        • Chambers M.
        • Burke R.
        • Agus D.
        • Mallick P.
        ProteoWizard: open source software for rapid proteomics tools development.
        Bioinformatics. 2008; 24: 2534-2536
        • Craig R.
        • Beavis R.C.
        TANDEM: matching proteins with tandem mass spectra.
        Bioinformatics. 2004; 20: 1466-1467
        • Eng J.K.
        • Jahan T.A.
        • Hoopmann M.R.
        Comet: an open-source MS/MS sequence database search tool.
        Proteomics. 2013; 13: 22-24
        • Baronti C.
        • Piorkowski G.
        • Charrel R.N.
        • Boubis L.
        • Leparc-Goffart I.
        • de Lamballerie X.
        Complete coding sequence of zika virus from a French polynesia outbreak in 2013.
        Genome Announc. 2014; 2: e00500-e00514
        • Shaw G.
        • Morse S.
        • Ararat M.
        • Graham F.L.
        Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells.
        Faseb J. 2002; 16: 869-871
        • Monel B.
        • Compton A.A.
        • Bruel T.
        • Amraoui S.
        • Burlaud-Gaillard J.
        • Roy N.
        • Guivel-Benhassine F.
        • Porrot F.
        • Genin P.
        • Meertens L.
        • Sinigaglia L.
        • Jouvenet N.
        • Weil R.
        • Casartelli N.
        • Demangel C.
        • Simon-Loriere E.
        • Moris A.
        • Roingeard P.
        • Amara A.
        • Schwartz O.
        Zika virus induces massive cytoplasmic vacuolization and paraptosis-like death in infected cells.
        EMBO J. 2017; 36: 1653-1668
        • Roux K.J.
        • Kim D.I.
        • Raida M.
        • Burke B.
        A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.
        J. Cell Biol. 2012; 196: 801-810
        • Uhlen M.
        • Oksvold P.
        • Fagerberg L.
        • Lundberg E.
        • Jonasson K.
        • Forsberg M.
        • Zwahlen M.
        • Kampf C.
        • Wester K.
        • Hober S.
        • Wernerus H.
        • Bjorling L.
        • Ponten F.
        Towards a knowledge-based Human Protein Atlas.
        Nat. Biotechnol. 2010; 28: 1248-1250
        • Lambert J.P.
        • Tucholska M.
        • Go C.
        • Knight J.D.
        • Gingras A.C.
        Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.
        J. Proteomics. 2015; 118: 81-94
        • Gupta G.D.
        • Coyaud E.
        • Goncalves J.
        • Mojarad B.A.
        • Liu Y.
        • Wu Q.
        • Gheiratmand L.
        • Comartin D.
        • Tkach J.M.
        • Cheung S.W.
        • Bashkurov M.
        • Hasegan M.
        • Knight J.D.
        • Lin Z.Y.
        • Schueler M.
        • Hildebrandt F.
        • Moffat J.
        • Gingras A.C.
        • Raught B.
        • Pelletier L.
        A dynamic protein interaction landscape of the human centrosome-cilium interface.
        Cell. 2015; 163: 1484-1499
        • Ma H.
        • Dang Y.
        • Wu Y.
        • Jia G.
        • Anaya E.
        • Zhang J.
        • Abraham S.
        • Choi J.G.
        • Shi G.
        • Qi L.
        • Manjunath N.
        • Wu H.
        A CRISPR-based screen identifies genes essential for West-Nile-virus-induced cell death.
        Cell Rep. 2015; 12: 673-683
        • Zhang R.
        • Miner J.J.
        • Gorman M.J.
        • Rausch K.
        • Ramage H.
        • White J.P.
        • Zuiani A.
        • Zhang P.
        • Fernandez E.
        • Zhang Q.
        • Dowd K.A.
        • Pierson T.C.
        • Cherry S.
        • Diamond M.S.
        A CRISPR screen defines a signal peptide processing pathway required by flaviviruses.
        Nature. 2016; 535: 164-168
        • Balinsky C.A.
        • Schmeisser H.
        • Ganesan S.
        • Singh K.
        • Pierson T.C.
        • Zoon K.C.
        Nucleolin interacts with the dengue virus capsid protein and plays a role in formation of infectious virus particles.
        J. Virol. 2013; 87: 13094-13106
        • Khaminets A.
        • Heinrich T.
        • Mari M.
        • Grumati P.
        • Huebner A.K.
        • Akutsu M.
        • Liebmann L.
        • Stolz A.
        • Nietzsche S.
        • Koch N.
        • Mauthe M.
        • Katona I.
        • Qualmann B.
        • Weis J.
        • Reggiori F.
        • Kurth I.
        • Hubner C.A.
        • Dikic I.
        Regulation of endoplasmic reticulum turnover by selective autophagy.
        Nature. 2015; 522: 354-358
        • Lennemann N.J.
        • Coyne C.B.
        Dengue and Zika viruses subvert reticulophagy by NS2B3-mediated cleavage of FAM134B.
        Autophagy. 2017; 13: 322-332
        • Bell T.M.
        • Field E.J.
        • Narang H.K.
        Zika virus infection of the central nervous system of mice.
        Arch Gesamte Virusforsch. 1971; 35: 183-193
        • Rossignol E.D.
        • Peters K.N.
        • Connor J.H.
        • Bullitt E.
        Zika virus induced cellular remodeling.
        Cell Microbiol. 2017; 19: e12740
        • Samsa M.M.
        • Mondotte J.A.
        • Iglesias N.G.
        • Assuncao-Miranda I.
        • Barbosa-Lima G.
        • Da Poian A.T.
        • Bozza P.T.
        • Gamarnik A.V.
        Dengue virus capsid protein usurps lipid droplets for viral particle formation.
        PLoS Pathog. 2009; 5: e1000632
        • Grant A.
        • Ponia S.S.
        • Tripathi S.
        • Balasubramaniam V.
        • Miorin L.
        • Sourisseau M.
        • Schwarz M.C.
        • Sanchez-Seco M.P.
        • Evans M.J.
        • Best S.M.
        • Garcia-Sastre A.
        Zika virus targets human STAT2 to inhibit type I interferon signaling.
        Cell Host Microbe. 2016; 19: 882-890
        • Barry M.
        • Fruh K.
        Viral modulators of cullin RING ubiquitin ligases: culling the host defense.
        Sci STKE. 2006; 2006: pe21
        • Machyna M.
        • Heyn P.
        • Neugebauer K.M.
        Cajal bodies: where form meets function.
        Wiley Interdiscip. Rev. RNA. 2013; 4: 17-34
        • Hofer C.T.
        • Jolmes F.
        • Haralampiev I.
        • Veit M.
        • Herrmann A.
        Influenza A virus nucleoprotein targets subnuclear structures.
        Cell Microbiol. 2016; 19: e12679
        • Sivan G.
        • Ormanoglu P.
        • Buehler E.C.
        • Martin S.E.
        • Moss B.
        Identification of restriction factors by human genome-wide RNA interference screening of viral host range mutants exemplified by discovery of SAMD9 and WDR6 as inhibitors of the Vaccinia virus K1L-C7L- mutant.
        MBio. 2015; 6: e01122
        • Cleret-Buhot A.
        • Zhang Y.
        • Planas D.
        • Goulet J.P.
        • Monteiro P.
        • Gosselin A.
        • Wacleche V.S.
        • Tremblay C.L.
        • Jenabian M.A.
        • Routy J.P.
        • El-Far M.
        • Chomont N.
        • Haddad E.K.
        • Sekaly R.P.
        • Ancuta P.
        Identification of novel HIV-1 dependency factors in primary CCR4(+)CCR6(+)Th17 cells via a genome-wide transcriptional approach.
        Retrovirology. 2015; 12: 102
        • Sessions O.M.
        • Barrows N.J.
        • Souza-Neto J.A.
        • Robinson T.J.
        • Hershey C.L.
        • Rodgers M.A.
        • Ramirez J.L.
        • Dimopoulos G.
        • Yang P.L.
        • Pearson J.L.
        • Garcia-Blanco M.A.
        Discovery of insect and human dengue virus host factors.
        Nature. 2009; 458: 1047-1050
        • Krishnan M.N.
        • Ng A.
        • Sukumaran B.
        • Gilfoy F.D.
        • Uchil P.D.
        • Sultana H.
        • Brass A.L.
        • Adametz R.
        • Tsui M.
        • Qian F.
        • Montgomery R.R.
        • Lev S.
        • Mason P.W.
        • Koski R.A.
        • Elledge S.J.
        • Xavier R.J.
        • Agaisse H.
        • Fikrig E.
        RNA interference screen for human genes associated with West Nile virus infection.
        Nature. 2008; 455: 242-245
        • Balderhaar H.J.
        • Ungermann C.
        CORVET and HOPS tethering complexes - coordinators of endosome and lysosome fusion.
        J. Cell Sci. 2013; 126: 1307-1316
        • Carette J.E.
        • Raaben M.
        • Wong A.C.
        • Herbert A.S.
        • Obernosterer G.
        • Mulherkar N.
        • Kuehne A.I.
        • Kranzusch P.J.
        • Griffin A.M.
        • Ruthel G.
        • Dal Cin P.
        • Dye J.M.
        • Whelan S.P.
        • Chandran K.
        • Brummelkamp T.R.
        Ebola virus entry requires the cholesterol transporter Niemann-Pick C1.
        Nature. 2011; 477: 340-343
        • Lei J.
        • Hansen G.
        • Nitsche C.
        • Klein C.D.
        • Zhang L.
        • Hilgenfeld R.
        Crystal structure of Zika virus NS2B-NS3 protease in complex with a boronate inhibitor.
        Science. 2016; 353: 503-505
        • Gabriel E.
        • Ramani A.
        • Karow U.
        • Gottardo M.
        • Natarajan K.
        • Gooi L.M.
        • Goranci-Buzhala G.
        • Krut O.
        • Peters F.
        • Nikolic M.
        • Kuivanen S.
        • Korhonen E.
        • Smura T.
        • Vapalahti O.
        • Papantonis A.
        • Schmidt-Chanasit J.
        • Riparbelli M.
        • Callaini G.
        • Kronke M.
        • Utermohlen O.
        • Gopalakrishnan J.
        Recent Zika virus isolates induce premature differentiation of neural progenitors in human brain organoids.
        Cell Stem Cell. 2017; 20: 397-406.e5
        • Wolf B.
        • Diop F.
        • Ferraris P.
        • Wichit S.
        • Busso C.
        • Misse D.
        • Gonczy P.
        Zika virus causes supernumerary foci with centriolar proteins and impaired spindle positioning.
        Open Biol. 2017; 7: 160231
        • Zhang Q.
        • Li Y.
        • Zhang Y.
        • Torres V.E.
        • Harris P.C.
        • Ling K.
        • Hu J.
        GTP-binding of ARL-3 is activated by ARL-13 as a GEF and stabilized by UNC-119.
        Sci Rep. 2016; 6: 24534
        • Macca M.
        • Franco B.
        The molecular basis of oral-facial-digital syndrome, type 1.
        Am. J. Med. Genet. C Semin. Med. Genet. 2009; 151C: 318-325
        • Tsuchiya Y.
        • Yoshiba S.
        • Gupta A.
        • Watanabe K.
        • Kitagawa D.
        Cep295 is a conserved scaffold protein required for generation of a bona fide mother centriole.
        Nat. Commun. 2016; 7: 12567
        • Chen C.
        • Tian F.
        • Lu L.
        • Wang Y.
        • Xiao Z.
        • Yu C.
        • Yu X.
        Characterization of Cep85 - a new antagonist of Nek2A that is involved in the regulation of centrosome disjunction.
        J. Cell Sci. 2015; 128: 3290-3303
        • Odendall C.
        • Kagan J.C.
        Peroxisomes and the antiviral responses of mammalian cells.
        Subcell. Biochem. 2013; 69: 67-75
        • Tanner L.B.
        • Chng C.
        • Guan X.L.
        • Lei Z.
        • Rozen S.G.
        • Wenk M.R.
        Lipidomics identifies a requirement for peroxisomal function during influenza virus replication.
        J. Lipid Res. 2014; 55: 1357-1365
        • Hua R.
        • Cheng D.
        • Freeman S.
        • Di Pietro E.
        • Coyaud E.
        • Wang Y.
        • Vissa A.
        • Demers N.
        • Yip C.M.
        • Fairn G.D.
        • Braverman N.
        • Brumell J.
        • Trimble W.
        • Raught B.
        • Kim P.K.
        VAPs and ACBD5 tether peroxisomes to the ER for peroxisome maintenance and lipid homeostasis.
        J. Cell Biol. 2017; 216: 367-377
        • Costello J.L.
        • Castro I.G.
        • Hacker C.
        • Schrader T.A.
        • Metz J.
        • Zeuschner D.
        • Azadi A.S.
        • Godinho L.F.
        • Costina V.
        • Findeisen P.
        • Manner A.
        • Islinger M.
        • Schrader M.
        ACBD5 and VAPB mediate membrane associations between peroxisomes and the ER.
        J. Cell Biol. 2017; 216: 331-342
        • Sacksteder K.A.
        • Jones J.M.
        • South S.T.
        • Li X.
        • Liu Y.
        • Gould S.J.
        PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis.
        J. Cell Biol. 2000; 148: 931-944
        • South S.T.
        • Sacksteder K.A.
        • Li X.
        • Liu Y.
        • Gould S.J.
        Inhibitors of COPI and COPII do not block PEX3-mediated peroxisome synthesis.
        J. Cell Biol. 2000; 149: 1345-1360
        • Luo D.
        • Vasudevan S.G.
        • Lescar J.
        The flavivirus NS2B-NS3 protease-helicase as a target for antiviral drug development.
        Antiviral Res. 2015; 118: 148-158
        • Blazevic J.
        • Rouha H.
        • Bradt V.
        • Heinz F.X.
        • Stiasny K.
        Membrane anchors of the structural flavivirus proteins and their role in virus assembly.
        J. Virol. 2016; 90: 6365-6378
        • Kaufusi P.H.
        • Kelley J.F.
        • Yanagihara R.
        • Nerurkar V.R.
        Induction of endoplasmic reticulum-derived replication-competent membrane structures by West Nile virus non-structural protein 4B.
        PLoS ONE. 2014; 9: e84040
        • Li X.D.
        • Deng C.L.
        • Ye H.Q.
        • Zhang H.L.
        • Zhang Q.Y.
        • Chen D.D.
        • Zhang P.T.
        • Shi P.Y.
        • Yuan Z.M.
        • Zhang B.
        Transmembrane domains of NS2B contribute to both viral RNA replication and particle formation in Japanese encephalitis virus.
        J. Virol. 2016; 90: 5735-5749
        • Martin-Acebes M.A.
        • Vazquez-Calvo A.
        • Saiz J.C.
        Lipids and flaviviruses, present and future perspectives for the control of dengue, Zika, and West Nile viruses.
        Prog. Lipid Res. 2016; 64: 123-137
        • You J.
        • Hou S.
        • Malik-Soni N.
        • Xu Z.
        • Kumar A.
        • Rachubinski R.A.
        • Frappier L.
        • Hobman T.C.
        Flavivirus infection impairs peroxisome biogenesis and early antiviral signaling.
        J. Virol. 2015; 89: 12349-12361
        • Oliveira E.R.A.
        • Mohana-Borges R.
        • de Alencastro R.B.
        • Horta B.A.C.
        The flavivirus capsid protein: Structure, function and perspectives towards drug design.
        Virus Res. 2017; 227: 115-123
        • Hou W.
        • Cruz-Cosme R.
        • Armstrong N.
        • Obwolo L.A.
        • Wen F.
        • Hu W.
        • Luo M.H.
        • Tang Q.
        Molecular cloning and characterization of the genes encoding the proteins of Zika virus.
        Gene. 2017; 628: 117-128
        • Wang S.H.
        • Syu W.J.
        • Huang K.J.
        • Lei H.Y.
        • Yao C.W.
        • King C.C.
        • Hu S.T.
        Intracellular localization and determination of a nuclear localization signal of the core protein of dengue virus.
        J. Gen. Virol. 2002; 83: 3093-3102
        • Kodani A.
        • Yu T.W.
        • Johnson J.R.
        • Jayaraman D.
        • Johnson T.L.
        • Al-Gazali L.
        • Sztriha L.
        • Partlow J.N.
        • Kim H.
        • Krup A.L.
        • Dammermann A.
        • Krogan N.J.
        • Walsh C.A.
        • Reiter J.F.
        Centriolar satellites assemble centrosomal microcephaly proteins to recruit CDK2 and promote centriole duplication.
        Elife. 2015; 4: e07519
        • Chavali P.L.
        • Putz M.
        • Gergely F.
        Small organelle, big responsibility: the role of centrosomes in development and disease.
        Philos. Trans. R. Soc. Lond. B Biol. Sci. 2014; 369: 20130468