Advertisement

Identification of Oligosaccharides in Feces of Breast-fed Infants and Their Correlation with the Gut Microbial Community*

  • Jasmine C.C. Davis
    Affiliations
    Department of Chemistry, University of California, Davis, California 95616;

    Foods for Health Institute, University of California, Davis, California 95616;
    Search for articles by this author
  • Sarah M. Totten
    Footnotes
    Affiliations
    Department of Chemistry, University of California, Davis, California 95616;

    Foods for Health Institute, University of California, Davis, California 95616;
    Search for articles by this author
  • Julie O. Huang
    Affiliations
    Department of Chemistry, University of California, Davis, California 95616;
    Search for articles by this author
  • Sadaf Nagshbandi
    Affiliations
    Department of Chemistry, University of California, Davis, California 95616;
    Search for articles by this author
  • Nina Kirmiz
    Affiliations
    Foods for Health Institute, University of California, Davis, California 95616;

    Department of Food Science and Technology, University of California, Davis, California 95616;
    Search for articles by this author
  • Daniel A. Garrido
    Footnotes
    Affiliations
    Foods for Health Institute, University of California, Davis, California 95616;

    Department of Viticulture and Enology, University of California, Davis, California 95616
    Search for articles by this author
  • Zachery T. Lewis
    Affiliations
    Foods for Health Institute, University of California, Davis, California 95616;

    Department of Food Science and Technology, University of California, Davis, California 95616;
    Search for articles by this author
  • Lauren D. Wu
    Affiliations
    Department of Chemistry, University of California, Davis, California 95616;

    Foods for Health Institute, University of California, Davis, California 95616;
    Search for articles by this author
  • Jennifer T. Smilowitz
    Affiliations
    Foods for Health Institute, University of California, Davis, California 95616;

    Department of Food Science and Technology, University of California, Davis, California 95616;
    Search for articles by this author
  • J. Bruce German
    Affiliations
    Foods for Health Institute, University of California, Davis, California 95616;

    Department of Food Science and Technology, University of California, Davis, California 95616;
    Search for articles by this author
  • David A. Mills
    Affiliations
    Foods for Health Institute, University of California, Davis, California 95616;

    Department of Food Science and Technology, University of California, Davis, California 95616;

    Department of Viticulture and Enology, University of California, Davis, California 95616
    Search for articles by this author
  • Carlito B. Lebrilla
    Correspondence
    To whom correspondence should be addressed:Department of Chemistry, University of California, Davis, One Shields Avenue, Davis, CA 95616. Tel.:530-752-6364; Fax:530-752-8995;
    Affiliations
    Department of Chemistry, University of California, Davis, California 95616;

    Foods for Health Institute, University of California, Davis, California 95616;
    Search for articles by this author
  • Author Footnotes
    * The work was also funded in part by National Institutes of Health Awards AT007079 (D.A.M.), HD061923 (C.B.L.), and AT008759 (D.A.M.), and the Peter J. Shields Endowed Chair in Dairy Food Science (D.A.M.). Z.T.L was funded by a postdoctoral fellowship from the Alfred P. Sloan Foundation Microbiology of the Built Environment Program. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
    This article contains supplemental material.
    1 The abbreviations used are:Bif-TRFLPBifidobacterium-specific terminal restriction fragment length polymorphismBLIRBifidobacterium longum/infantis ratioECCextracted compound chromatogramFAformic acidFucFucoseGalGalactoseGCCgraphitized carbon cartridgeGlcGlucoseGlcNAcN-acetylglucosamineHexHexoseHexNAcN-acetylhexosamineHMOhuman milk oligosaccharideIFLNH Iisomer 1 fucosyl-paralacto-N-hexaoseIFLNH IIIisomer 3 fucosyl-paralacto-N-hexaoseLNHlacto-N-hexaoseLNnHlacto-N-neohexaoseLNTlacto-N-tetraoseLNnTlacto-N-neotetraoseMFLNH Imonofucosyllacto-N-hexaose INeu5AcN-acetylneuraminic acidp-LNHpara-lacto-N-hexaose2′FL2′-fucosyllactose.
    ‡‡ Current association: Canary Center at Stanford, Stanford University School of Medicine, CA 94305.
    §§ Current association: Department of Chemical and Bioprocess Engineering Pontificia Universidad Católica de Chile, Vicuña Mackenna 4860, Santiago, Chile.
Open AccessPublished:July 19, 2016DOI:https://doi.org/10.1074/mcp.M116.060665
      Glycans in breast milk are abundant and found as either free oligosaccharides or conjugated to proteins and lipids. Free human milk oligosaccharides (HMOs) function as prebiotics by stimulating the growth of beneficial bacteria while preventing the binding of harmful bacteria to intestinal epithelial cells. Bacteria have adapted to the glycan-rich environment of the gut by developing enzymes that catabolize glycans. The decrease in HMOs and the increase in glycan digestion products give indications of the active enzymes in the microbial population. In this study, we quantitated the disappearance of intact HMOs and characterized the glycan digestion products in the gut that are produced by the action of microbial enzymes on HMOs and glycoconjugates from breast milk. Oligosaccharides from fecal samples of exclusively breast-fed infants were extracted and profiled using nanoLC-MS. Intact HMOs were found in the fecal samples, additionally, other oligosaccharides were found corresponding to degraded HMOs and non-HMO based compounds. The latter compounds were fragments of N-glycans released through the cleavage of the linkage to the asparagine residue and through cleavage of the chitobiose core of the N-glycan. Marker gene sequencing of the fecal samples revealed bifidobacteria as the dominant inhabitants of the infant gastrointestinal tracts. A glycosidase from Bifidobacterium longum subsp. longum was then expressed to digest HMOs in vitro, which showed that the digested oligosaccharides in feces corresponded to the action of glycosidases on HMOs. Similar expression of endoglycosidases also showed that N-glycans were released by bacterial enzymes. Although bifidobacteria may dominate the gut, it is possible that specific minority species are also responsible for the major products observed in feces. Nonetheless, the enzymatic activity correlated well with the known glycosidases in the respective bacteria, suggesting a direct relationship between microbial abundances and catabolic activity.
      Breast milk is composed of lactose, lipids, free oligosaccharides, and proteins, many of which are highly glycosylated (
      • Ruhaak L.R.
      • Lebrilla C.B.
      Analysis and role of oligosaccharides in milk.
      ,
      • Nwosu C.C.
      • Aldredge D.L.
      • Lee H.
      • Lerno L.A.
      • Zivkovic A.M.
      • German J.B.
      • Lebrilla C.B.
      Comparison of the human and bovine milk N-Glycome via high-performance microfluidic chip liquid chromatography and tandem mass spectrometry.
      ,
      • Liao Y.
      • Alvarado R.
      • Phinney B.
      • Lonnerdal B.
      Proteomic characterization of human milk whey proteins during a twelve-month lactation period.
      ,
      • Bode L.
      Human milk oligosaccharides: Every baby needs a sugar mama.
      ). Human milk oligosaccharides (HMOs)
      The abbreviations used are:
      Bif-TRFLP
      Bifidobacterium-specific terminal restriction fragment length polymorphism
      BLIR
      Bifidobacterium longum/infantis ratio
      ECC
      extracted compound chromatogram
      FA
      formic acid
      Fuc
      Fucose
      Gal
      Galactose
      GCC
      graphitized carbon cartridge
      Glc
      Glucose
      GlcNAc
      N-acetylglucosamine
      Hex
      Hexose
      HexNAc
      N-acetylhexosamine
      HMO
      human milk oligosaccharide
      IFLNH I
      isomer 1 fucosyl-paralacto-N-hexaose
      IFLNH III
      isomer 3 fucosyl-paralacto-N-hexaose
      LNH
      lacto-N-hexaose
      LNnH
      lacto-N-neohexaose
      LNT
      lacto-N-tetraose
      LNnT
      lacto-N-neotetraose
      MFLNH I
      monofucosyllacto-N-hexaose I
      Neu5Ac
      N-acetylneuraminic acid
      p-LNH
      para-lacto-N-hexaose
      2′FL
      2′-fucosyllactose.
      and glycoproteins are vital components of breast milk and protect the infant from bacterial infection (
      • Kunz C.
      • Rudloff S.
      Biological functions of oligosaccharides in human milk.
      ). HMOs play a role in deflecting pathogen binding to gut epithelial cells via molecular mimicry (
      • Newburg D.S.
      • Ruiz-Palacios G.
      • Morrow A.L.
      Human Milk Glycans Protect Infants Against Enteric Pathogens.
      ). With over 200 identified structures, HMOs are a diverse group of oligosaccharides (
      • Wu S.
      • Grimm R.
      • German J.B.
      • Lebrilla C.B.
      Annotation and structural analysis of sialylated human milk oligosaccharides.
      ,
      • Wu S.
      • Tao N.
      • German J.B.
      • Grimm R.
      • Lebrilla C.B.
      Development of an annotated library of neutral human milk oligosaccharides.
      ,
      • Marino K.
      • Lane J.A.
      • Abrahams J.L.
      • Struew W.B.
      • Harvey D.J.
      • Marotta M.
      • Hickey R.M.
      • Rudd P.M.
      Method for milk oligosaccharide profiling by 2-aminobenzamide labeling and hydrophilic interaction chromatography.
      ,
      • Kobata A.
      Structures and application of oligosaccharides in human milk.
      ). There are five common monosaccharides that make up HMOs: glucose (Glc), galactose (Gal), N-acetylglucosamine (GlcNAc), fucose (Fuc), and sialic acid, N-acetylneuraminic acid (Neu5Ac). Most HMOs contain a lactose core (Gal(β1–4)Glc) and are extended by glycosyltransferases that add GlcNAc residues in β(1–3/6) linkages and Gal in β(1–3/4) linkages (
      • Kunz C.
      • Rudloff S.
      Biological functions of oligosaccharides in human milk.
      ). These chains can then be decorated by Fuc in various linkages, depending on the specific enzymes of the mother. Fuc added in α(1–3/4) linkages are controlled by the Lewis gene to both Glc and GlcNAc residues, and the secretor gene (FUT2) codes for the α(1–2) fucosyltransferase, which adds Fuc in an α(1–2) linkage on a terminal Gal residue (
      • Thurl S.
      • Henker J.
      • Siegel M.
      • Tovar K.
      • Sawatzki G.
      Detection of four human milk groups with respect to Lewis blood group dependent oligosaccharides.
      ). Neu5Ac can also be added via α(2–3/6) linkages to GlcNAc or terminal Gal residues (
      • Ruhaak L.R.
      • Lebrilla C.B.
      Analysis and role of oligosaccharides in milk.
      ,
      • Kunz C.
      • Rudloff S.
      • Baier W.
      • Klein N.
      • Strobel S.
      Oligosaccharides in Human Milk: Structural, Functional, and Metabolic Aspects.
      ,
      • Urashima T.
      • Kitaoka M.
      • Asakuma S.
      • Messer M.
      Milk Oligosaccharides.
      ).
      The role of milk in developing the gastrointestinal microbiome appears to be critical in infant development. HMOs are not catabolized directly by the infant, but instead pass undigested through the upper digestive tract to the large intestine where they function as prebiotics for the distal gut microbiota (
      • Bode L.
      Human milk oligosaccharides: Every baby needs a sugar mama.
      ,
      • Engfer M.B.
      • Stahl B.
      • Finke B.
      • Sawatzki G.
      • Daniel H.
      Human milk oligosaccharides are resistant to enzymatic hydrolysis in the upper gastrointestinal tract.
      ,
      • Chaturvedi P.
      • Warren C.D.
      • Buescher C.R.
      • Pickering L.K.
      • Newburg D.S.
      Survival of human milk oligosaccharides in the intestine of infants.
      ,
      • Coppa G.V.
      • Pierani P.
      • Zampini L.
      • Bruni S.
      • Carloni I.
      • Gabrielli O.
      Characterization of oligosaccharides in milk and feces of breast-fed infants by high-performance anion-exchange chromatography.
      ). HMOs help promote a healthy infant gastrointestinal tract in a number of ways: as anti-adhesives preventing viruses from binding to epithelial cell surface glycans, as antimicrobials acting as decoy receptors to pathogenic bacteria, and as energy sources for beneficial bacteria which in turn produce short-chain fatty acids for the infant (
      • Bode L.
      Human milk oligosaccharides: Every baby needs a sugar mama.
      ,
      • Newburg D.S.
      • Ruiz-Palacios G.
      • Morrow A.L.
      Human Milk Glycans Protect Infants Against Enteric Pathogens.
      ,
      • Arora T.
      • Sharma R.
      Fermentation potential of the gut microbiome: implications for energy homeostasis and weight management.
      ,
      • Macfarlane S.
      • Macfarlane G.T.
      Regulations of short-chain fatty acid production.
      ). Commensal bacteria such as Bifidobacterium and Bacteroides are equipped with a suite of enzymes capable of breaking down HMOs (
      • Marcobal A.
      • Sonnenburg J.L.
      Human milk oligosaccharide consumption by intestinal microbiota.
      ,

      German, J. B., Freeman, S. L., Lebrilla, C. B., and Mills, D. A., (2007) Human Milk Oligosaccharides: Evolution, Structures, and Bioselectivity as Substrates for Intestinal Bacteria. In: Bier, D. M., German, J. B., and B., L., eds. 62nd Nestle Nutrition Workshop, Pediatric Program, pp. 205–222, Helsinki, Finland.

      ,
      • Ward R.E.
      • Ninonuevo M.R.
      • Mills D.A.
      • Lebrilla C.B.
      • German J.B.
      In vitro fermentation of breast milk oligosaccharides by Bifidobacterium infantis and Lactobacillus gasseri.
      ). For this reason, bifidobacteria can make up to 90% of the microbial community in the gut of breast-fed infants (
      • Kunz C.
      • Rudloff S.
      Biological functions of oligosaccharides in human milk.
      ,
      • Murphy E.
      • Murphy C.
      • O'Mahony L.
      Influence of the Gut Microbiota with Ageing.
      ). Select bifidobacterial species grow well on HMOs in vitro (
      • Ward R.E.
      • Ninonuevo M.R.
      • Mills D.A.
      • Lebrilla C.B.
      • German J.B.
      In vitro fermentation of breast milk oligosaccharides by Bifidobacterium infantis and Lactobacillus gasseri.
      ,
      • Garrido D.
      • Dallas D.C.
      • Mills D.A.
      Consumption of human milk glycoconjugates by infant-associated bifidobacteria: mechanisms and implications.
      ). Bifidobacterium longum subsp. infantis has been shown to be particularly good at utilizing HMOs, displaying preferential consumption of smaller and fucosylated HMOs (
      • Ward R.E.
      • Ninonuevo M.R.
      • Mills D.A.
      • Lebrilla C.B.
      • German J.B.
      In vitro fermentation of breast milk oligosaccharides by Bifidobacterium infantis and Lactobacillus gasseri.
      ,
      • Garrido D.
      • Dallas D.C.
      • Mills D.A.
      Consumption of human milk glycoconjugates by infant-associated bifidobacteria: mechanisms and implications.
      ,
      • LoCascio R.G.
      • Ninonuevo M.R.
      • Freeman S.L.
      • Sela D.A.
      • Grimm R.
      • Lebrilla C.B.
      • Mills D.A.
      • German J.B.
      Glycoprofiling of bifodobaterial consumption of human milk oligosaccharides demonstrates strain specific, preferential consumption of small chain glycans secreted in early human lactation.
      ). Different microbial species and strains in the infant gastrointestinal tract have their own mechanisms for HMO catabolism leading to potentially diverse digested products in the feces. These digestion products are generally unknown, but characterizing these glycan species may reveal information regarding the repertoire of specific bacterial enzymes at work and indicate the active members in the communities inhabiting the infant gastrointestinal tract.
      The in vivo catabolism of HMOs can provide important phenotypic information regarding the state of the gut microbiota. Along with the degraded HMO, intact HMOs have also been discovered in the feces of breast-fed infants (
      • Chaturvedi P.
      • Warren C.D.
      • Buescher C.R.
      • Pickering L.K.
      • Newburg D.S.
      Survival of human milk oligosaccharides in the intestine of infants.
      ,
      • Coppa G.V.
      • Pierani P.
      • Zampini L.
      • Bruni S.
      • Carloni I.
      • Gabrielli O.
      Characterization of oligosaccharides in milk and feces of breast-fed infants by high-performance anion-exchange chromatography.
      ,
      • Albrecht S.
      • Schols H.A.
      • van den Heuvel E.G.H.M.
      • Voragen A.G.J.
      • Gruppen H.
      Occurrence of oligosaccharides in feces of breast-fed babies in their first six months of life and the corresponding breast milk.
      ,
      • De Leoz M.L.A.
      • Wu S.
      • Strum J.S.
      • Ninonuevo M.R.
      • Gaerlan S.C.
      • Mirmiran M.
      • German J.B.
      • Mills D.A.
      • Lebrilla C.B.
      • Underwood M.A.
      A quantitative and comprehensive method to analyze human milk oligosaccharide structures in the urine and feces of infants.
      ). Computational, genomic, and in vitro methods have been combined to study bacterial consumption of HMOs and other carbohydrates. Eilam et al. created a computational program using genomic data of microbial enzymes in order to predict degraded glycan products (
      • Eilam O.
      • Zarecki R.
      • Oberhardt M.
      • Ursell L.K.
      • Kupiec M.
      • Knight R.
      • Gophna U.
      • Ruppin E.
      Glycan Degradation (GlyDeR) Analysis predicts mammalian gut microbiota abundance and host diet-specific adaptations.
      ). Asakuma et al. grew several bifidobacteria strains on select HMO-enriched media and discovered various mechanisms for producing digestion products from the in vitro bacterial growth (
      • Asakuma S.
      • Hatakeyama E.
      • Urashima T.
      • Yoshida E.
      • Katayama T.
      • Yamamoto K.
      • Kumagai H.
      • Ashida H.
      • Hirose J.
      • Kitaoka M.
      Physiology of consumption of human milk oligosaccharides by infant gut-associated Bifidobacteria.
      ). Further studies found important distinctions for the feeding habits among specific bacterial species. B. longum subsp. infantis catabolizes the entire HMO internally, whereas B. bifidum secretes extracellular glycosidases for cleaving HMOs, leading to digested HMO products in the intestinal lumen (
      • LoCascio R.G.
      • Ninonuevo M.R.
      • Kronewitter S.R.
      • Freeman S.L.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      A versatile and scalable strategy for glycoprofiling bifidobacterial consumption of human milk oligosaccharides.
      ,
      • Sela D.A.
      • Mills D.A.
      Nursing our microbiota: molecular linkages between bifidobacteria and milk oligosaccharides.
      ). These studies show that degraded glycans are created through the activity of key glycosyl hydrolases and can link relevant glycosidases with specific bacteria, thus providing insight into possible gut microbiota degradation pathways witnessed in feces.
      In this study, we extracted and characterized intact oligosaccharides and digestion products from the feces of breast-fed infants to obtain the most comprehensive oligosaccharide analysis of feces. We compare the fecal oligosaccharides with matched maternal breast milk, and gained insight into the active glycosidases in the intestinal microbiome. The fecal glycans act as a phenotypic signature indicative of the enzymes that are active in the microbial communities in the infant gut. Genomic profiling of the types of microbial species present in infants' guts was used to infer those glycosidases. Intact and degraded oligosaccharides from milk glycoconjugates were identified and a fecal glycan library was created for the rapid and comprehensive analysis of postpartum alterations to the fecal glycome.

      EXPERIMENTAL PROCEDURES

      Breast Milk and Infant Fecal Samples

      Milk samples were obtained from healthy women enrolled in the Foods for Health Institute Lactation Study at the University of California, Davis. Sample collection and subject details have been previously reported (
      • Lewis Z.T.
      • Totten S.M.
      • Smilowitz J.T.
      • Popovic M.
      • Parker E.
      • Lemay D.G.
      • Van Tassell M.L.
      • Miller M.J.
      • Jin Y.S.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      Maternal fucosyltransferase 2 status affects the gut bifidobacterial communities of breastfed infants.
      ,
      • Ferris A.M.
      • Jensen R.G.
      Lipids in Human Milk: A Review. 1: Sampling, determination, and content.
      ). The UC Davis Institutional Review Board approved all aspects of the study, and informed consent was obtained from all subjects. This trial was registered on clinicaltrials.gov (ClinicalTrials.gov Identifier: NCT01817127). For this study, a subset of one mother/infant pair and six infant fecal samples were analyzed. Briefly, milk samples were collected in the morning on day 6, 21/24, 71, and/or 120 postpartum. Subjects fully pumped one breast into a bottle, inverted six times, transferred 12 ml into a 15 ml polypropylene tube, and subsequently froze the sample in their kitchen freezers (−20 °C). Samples were collected from the subjects' freezers by study personnel biweekly, transported to the lab on dry ice, and stored at −80 °C until processing. Infant fecal samples were collected at 6/7, 21/24, 71, and/or 120 days of life. Parents transferred their infant fecal samples into sterile plastic tubes and were instructed to immediately store the samples at −20 °C until transported by study personnel. Fecal samples were transported to the laboratory on ice packs and stored at −80 °C before processing.

      Oligosaccharide Extraction

      Free oligosaccharides were extracted from breast milk and infant feces following previously reported methods, with slight modifications (
      • Wu S.
      • Tao N.
      • German J.B.
      • Grimm R.
      • Lebrilla C.B.
      Development of an annotated library of neutral human milk oligosaccharides.
      ,
      • De Leoz M.L.A.
      • Wu S.
      • Strum J.S.
      • Ninonuevo M.R.
      • Gaerlan S.C.
      • Mirmiran M.
      • German J.B.
      • Mills D.A.
      • Lebrilla C.B.
      • Underwood M.A.
      A quantitative and comprehensive method to analyze human milk oligosaccharide structures in the urine and feces of infants.
      ,
      • Totten S.M.
      • Wu L.D.
      • Parker E.A.
      • Davis J.C.C.
      • Hua S.
      • Stroble C.
      • Ruhaak L.R.
      • Smilowitz J.T.
      • German J.B.
      • Lebrilla C.B.
      Rapid-throughput glycomics applied to human milk oligosaccharide profiling for large human studies.
      ). Fecal samples were weighed, diluted with nanopure water to 1 mg/10 μl, and homogenized in the shaker overnight at 4 °C. The samples were then centrifuged at 4000 × g for 30 min, and 100 μl of supernatant was taken and placed on a 96-well plate. For the milk samples, 50 μl were aliquoted on a 96-well plate and defatted via centrifugation. The skimmed milk and fecal supernatants then underwent similar methods. Proteins were removed by ethanol precipitation at −80 °C for 1.5 h, and after 30 min of centrifugation the supernatant was evaporated to dryness. The resulting glycans were reduced to their alditol form with 1.0 m NaBH4 at 65 °C for 1.5 h. Desalting and purification was achieved using solid phase extraction on both C-8 and graphitized carbon cartridges (GCCs) (Glygen Corp, Columbia, MD) for the fecal samples but only GCCs for milk. After the glycans were loaded onto preconditioned C8 cartridges, the flow-through was collected and the glycans were loaded onto preconditioned GCCs. The purified glycans were eluted with 20% acetonitrile (ACN)/water (v/v) and 40% ACN/water (v/v) in 0.05% trifluoroacetic acid, eluent solvent then evaporated to dryness, and reconstituted and diluted in nanopure water before analysis.

      Nano-High Performance Liquid Chromatography-Chip/Time-of-Flight Mass Spectrometry (nanoLC-MS)

      Milk and fecal glycans were analyzed on a nano-high performance liquid chromatography (HPLC)-chip/time-of-flight (TOF) mass spectrometry system. The HPLC system used was an Agilent 1200 series unit with a microfluidic chip, which was coupled to an Agilent 6220 series TOF mass spectrometer via chip cube interface. The capillary pump on the chromatography unit loads the sample onto the 40 nL enrichment column of the chip at a flow rate of 4.0 μl/min with a 1 μl injection volume. The nano pump is used for analyte separation on the analytical column of the chip, which is 75 μl x 43 mm and packed with porous graphitized carbon. Separation is accomplished using a binary gradient of aqueous solvent A (3% acetonitrile (ACN)/water (v/v) in 0.1% formic acid (FA)) and organic solvent B (90% ACN/water (v/v) in 0.1% FA) with a previously developed method for HMO separation (
      • Wu S.
      • Grimm R.
      • German J.B.
      • Lebrilla C.B.
      Annotation and structural analysis of sialylated human milk oligosaccharides.
      ,
      • Wu S.
      • Tao N.
      • German J.B.
      • Grimm R.
      • Lebrilla C.B.
      Development of an annotated library of neutral human milk oligosaccharides.
      ). The sample is then introduced into the TOF mass spectrometer via electrospray ionization, which was tuned and calibrated using a dual nebulizer electrospray source with calibrant ions ranging from m/z 118.086 to 2721.895, and data was collected in the positive mode.

      Nano-HPLC-Chip/Quadrupole-TOF MS

      Structural elucidation of fecal glycans was performed on a nano-HPLC-chip/quadrupole-TOF (Q-TOF) mass spectrometer, Agilent LC 1200 series and Q-TOF 6520 series. The chromatographic separation method on the Q-TOF was the same as that for the nano-HPLC-chip/TOF. Tandem mass spectrometry was also performed in the positive mode with collision induced dissociation for fragmentation. The following voltages were optimized for oligosaccharide fragmentation: fragmentor 175 V, skimmer 60 V, and octopole 1 RF 750 V, and nitrogen drying gas was used at a flow rate of 5 L/min at 325 °C. Auto MS/MS was used with 0.63 spectra/second for both MS 1 and MS/MS. Precursor ions were selected based on abundance, with doubly charged ions given first priority, singly charged ions second, triply charged third, then last, other multiply charged ions. All calibrant ions were excluded from precursor selection with a 4 m/z isolation window. Collision energy (CE) was based on the ion's mass-to-charge (m/z) ratio with higher energy for larger ions, according to the following equation
      CE(V)=m/z100(Da)×1.33.5
      (Eq. 1)


      where 1.3 is the slope and −3.5 is the y-intercept. The equation was empirically determined by the manufacturer (
      • Wu S.
      • Grimm R.
      • German J.B.
      • Lebrilla C.B.
      Annotation and structural analysis of sialylated human milk oligosaccharides.
      ).

      Oligosaccharide Data Analysis

      Data was collected using Agilent MassHunter Work station Data Acquisition version B.02.01 on the nanoHPLC-chip/TOF and version B.05.00 on the nanoHPLC-chip/Q-TOF and then analyzed with Agilent MassHunter Qualitative Analysis software versions B.03.01 and B.06.00. Glycans were identified using the Find Compounds by Molecular Feature function to within 20 ppm of theoretical masses. Compound abundances were extracted as volume in ion counts, which was directly correlated to absolute abundances of the compounds present in each sample. Known structures were identified by matching accurate mass and retention time to previously developed annotated HMO libraries which contains 102 composition entries (
      • Wu S.
      • Grimm R.
      • German J.B.
      • Lebrilla C.B.
      Annotation and structural analysis of sialylated human milk oligosaccharides.
      ,
      • Wu S.
      • Tao N.
      • German J.B.
      • Grimm R.
      • Lebrilla C.B.
      Development of an annotated library of neutral human milk oligosaccharides.
      ). Peak alignment for correcting for retention time shifts was performed using in-house software (
      • Totten S.M.
      • Wu L.D.
      • Parker E.A.
      • Davis J.C.C.
      • Hua S.
      • Stroble C.
      • Ruhaak L.R.
      • Smilowitz J.T.
      • German J.B.
      • Lebrilla C.B.
      Rapid-throughput glycomics applied to human milk oligosaccharide profiling for large human studies.
      ). Tandem MS data were then annotated by hand and in-house software. The MS data have been deposited to the Proteome Xchange Consortium via the PRIDE partner repository with the data set identifier PXD004434 (
      • Vizcaino J.A.
      • SCsordas A.
      • del-Toro N.
      • Dianes J.A.
      • Griss J.
      • Lavidas I.
      • Mayer G.
      • Perez-Riverol Y.
      • Reisinger F.
      • Ternent T.
      • Xu Q.W.
      • Wang R.
      • Hermjakob H.
      2016 update of the PRIDE database and related tools.
      ).

      Cloning and Protein Expression of BLNG_00015 from B. longum subsp. longum SC596

      BLNG_00015 (β-galactosidase) was cloned using the pEco-T7-cHis cloning kit (Gentarget Inc., San Diego, CA). The Qiagen DNeasy Blood & Tissue Kit was used to purify genomic DNA from B.longum subsp. longum SC596 culture following the manufacturer's guidelines for purification of Gram-positive bacterial DNA. BLNG_00015 was amplified by PCR. 225 μl of PCR product was gel purified and cloned into a pEco-T7-cHis (Gentarget Inc) vector. Sequencing of the insert of the recombinant BL21 Star clone was carried out to confirm the sequence of the entire glycosyl hydrolase insert. Protein expression was carried out using 700 ml of LB with 100 μg/ml carbenicillin. Cells were grown until an OD of 0.5 was reached and induced overnight using a final concentration of 0.5 mm isopropyl-β-d-thiogalactopyranoside. The culture was centrifuged using an Eppendorf 5804 centrifuge (Hauppauge, NY) for 20 min at 4 °C and frozen at −80 °C. Bugbuster protein extraction reagent (EMD chemicals, Gibbstown, NJ) was used to resuspend culture. 60 μl of DNase I (Roche, Basel, Switzerland) from a 10 U/μl stock and 120 μl of lysozyme from a 50 mg/ml stock were added per 20 ml of Bugbuster suspension. After a 5 min incubation, the Bugbuster suspension was then centrifuged for 30 min at 13,200 rpm at 4 °C. For purification a 1 ml Bio-Scale Mini Profinity immobilized-metal affinity chromatography column attached to a EP-1 Econo Pump (Bio-Rad, Hercules, CA) was used. Following purification, imidazole was exchanged with PBS using 10 kDa cutoff Amicon Ultra-15 centrifugal unit (Millipore, Billerica, CA). Purity and size of the recombinant protein were confirmed using a 4–15% SDS-PAGE gel.

      In vitro Enzyme Digestion

      Expressed enzymes were stored at −80 °C until analysis. A pool of HMOs (1.5 μl, 5 mg/ml) reduced to the alditol was combined with 3 μl of enzyme BLNG_00015 and 5.5 μl of 0.1 m ammonium acetate buffer at pH 6.0. The solution was incubated for 1 h at 55 °C followed by C18 zip-tip (Agilent Technologies, Santa Clara, CA) clean up. The samples were then dried and reconstituted in 50 μl nanopure water for analysis. This experiment was performed in triplicate. An undigested HMO pool (1.5 μl in 50 μl nanopure water) was run with the digested pool on the nano-HPLC-chip/TOF mass spectrometer.

      Fecal DNA Extraction

      DNA was extracted from 150 mg of stool sample using the ZR Fecal DNA MiniPrep kit (ZYMO, Irvine, CA) in accordance with the manufacturer's instructions, which included a bead-beating step using a FastPrep-24 Instrument (MP Biomedicals, Santa Ana, CA) for 2 min at 25 °C at a speed of 6.5 m/s.

      Bifidobacterium-specific Terminal Restriction Fragment Length Polymorphism (Bif-TRFLP)

      The method of Lewis et al. was used to perform the Bifidobacterium-specific terminal restriction fragment length polymorphism assay (
      • Lewis Z.T.
      • Bokulich N.A.
      • Kalanetra K.M.
      • Ruiz-Moyano S.
      • Underwood M.A.
      • Mills D.A.
      Use of bifidobacterial specific terminal restriction fragment length polymorphisms to complement next generation sequence profiling of infant gut communities.
      ). Briefly, DNA from feces was amplified in triplicate by PCR using primers NBIF389 (5′-[HEX]-GCCTTCGGGTTGTAAAC) and NBIF1018 REV (GACCATGCACCACCTGTG). DNA was purified using the Qiagen QIAquick PCR purification kit and then cut with restriction enzymes AluI and HaeIII. The resulting fragments were analyzed on an ABI 3100 genetic analyzer, and sizes were compared against the published database for species identification.

      Bifidobacterium longum/infantis Ratio (BLIR)

      A PCR-based assay, BLIR, was used to determine which subspecies of B. longum were present in each sample and to gain an estimate of their relative abundance to each other (
      • Lewis Z.T.
      • Shani G.
      • Masarweh C.F.
      • Popovic M.
      • Frese S.A.
      • Sela D.A.
      • Underwood M.A.
      • Mills D.A.
      Validating bifidobacterial species and subspecies identity in commercial probiotic products.
      ). Briefly, PCR was performed using three primers (FWD_BL_BI (5′-[HEX]-AAAACGTCCATCCATCACA), REV_BL (5′-ACGACCAGGTTCCACTTGAT), and REV_BI (5′-CGCCTCAGTTCTTTAATGT)) targeting a conserved portion of the genome (between Blon_0424 and Blon_0425) shared by both subspecies, but generating different amplicon lengths for each. Amplicons were analyzed by capillary electrophoresis on an ABI 3100 genetic analyzer (Applied Biosystems, Carlsbad, CA) and interpreted with PeakScanner 2.0 software (Applied Biosystems) to estimate relative abundances of each subspecies.

      Marker Gene Sequencing

      DNA samples were prepared for 16S rRNA marker gene sequencing as previously described (
      • Lewis Z.T.
      • Totten S.M.
      • Smilowitz J.T.
      • Popovic M.
      • Parker E.
      • Lemay D.G.
      • Van Tassell M.L.
      • Miller M.J.
      • Jin Y.S.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      Maternal fucosyltransferase 2 status affects the gut bifidobacterial communities of breastfed infants.
      ,
      • Caporaso J.G.
      • Lauber C.L.
      • Walters W.A.
      • Berg-Lyons D.
      • Lozupone C.A.
      • Turnbaugh P.J.
      • Fierer N.
      • Knight R.
      Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.
      ) with the following modifications. Universal barcoded primers with Illumina sequencing adapters (Illumina, San Diego, CA) (adapters are italicized and the barcode is highlighted in bold) V4F (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNNNNGTGTGCCAGCMGCCGCGGTAA-3′) and V4Rev (5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTCCGGACTACHVGGGTWTCTAAT-3′) were used to PCR amplify the V4 region of the 16S rRNA gene in each sample (
      • Caporaso J.G.
      • Lauber C.L.
      • Walters W.A.
      • Berg-Lyons D.
      • Lozupone C.A.
      • Turnbaugh P.J.
      • Fierer N.
      • Knight R.
      Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.
      ). A pooled library was sequenced at the University of California DNA Technologies Core Facility on an Illumina MiSeq platform (Illumina) (150 bp single read).

      Sequence Analysis

      The QIIME software package (version 1.7.0) was used to analyze the results of the Illumina sequencing run. Illumina V4 16S rRNA gene sequences (Illumina) were demultiplexed and quality filtered using the QIIME 1.7.0 software package with default settings unless otherwise specified (
      • Caporaso J.G.
      • Kuczynski J.
      • Stombaugh J.
      • Bittinger K.
      • Bushman F.D.
      • Costello E.K.
      • Fierer N.
      • Pena A.G.
      • Goodrich J.K.
      • Gordon J.I.
      • Huttley G.A.
      • Kelley S.T.
      • Knights D.
      • Koenig J.E.
      • Ley R.E.
      • Lozupone C.A.
      • Mcdonals D.
      • Muegge B.D.
      • Pirrung M.
      • Reeder J.
      • Sevindsky J.R.
      • Turnbugh P.J.
      • Walters W.A.
      • Widmann J.
      • Yatsunenko T.
      • Zaneveld J.
      • Knight R.
      QIIME allows analysis of high- throughput community sequencing data.
      ). Reads were truncated after a maximum number of three consecutive low quality scores. The minimum number of consecutive high-quality base calls to include a read (per single end read) as a fraction of the input read length was 0.75. The minimum acceptable Phred quality score was set at 20. Similar sequences were clustered into operational taxonomic units (OTUs) using open reference OTU picking with UCLUST software (
      • Edgar R.C.
      Search and clustering orders of magnitude faster than BLAST.
      ). Taxonomy was assigned to each OTU with the Ribosomal Database Project (RDP) classifier (
      • Wang Q.
      • Garrity G.M.
      • Tiedje J.M.
      • Cole J.R.
      Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.
      ) and the RDP taxonomic nomenclature (
      • Cole J.R.
      • Wang Q.
      • Cardenas E.
      • Fish J.
      • Chai B.
      • Farris R.J.
      • Kulam-Syed-Mohideen A.S.
      • McGarrell D.M.
      • Marsh T.
      • Garrity G.M.
      • Tiedje J.M.
      The Ribosomal Database Project: improved alignments and new tools for rRNA analysis.
      ). OTU representatives were aligned against the Greengenes core set (
      • DeSantis T.Z.
      • Hugenholtz P.
      • Larsen N.
      • Rojas M.
      • Brodie E.L.
      • Keller K.
      • Huber T.
      • Dalevi D.
      • Hu P.
      • Andersen G.L.
      Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.
      ) with PyNAST software (
      • Caporaso J.G.
      • Bittinger K.
      • Bushman F.D.
      • DeSantis T.Z.
      • Andersen G.L.
      • Knight R.
      PyNAST: a flexible tool for aligning sequences to a template alignment.
      ).

      RESULTS

      Glycomic Profile of Feces from Breast-fed Infants

      The considerations of potential sources of oligosaccharides in feces include HMOs, digested HMOs, and the digestion of other milk glycoconjugates including glycoproteins and glycolipids (Fig. 1). Fig. 2A shows the extracted compound chromatogram (ECC) of intact HMOs from a breast milk sample from one mother 24 days postpartum, and the ECC of a fecal sample from her offspring 24 days postnatal (mother/infant pair 1028) (Fig. 2B). The direct comparison of the nanoLC-MS glycan profile of the milk to that of infant feces yielded considerable overlap because of undigested HMO in feces. Nonetheless, even a casual inspection showed significant differences (Fig. 2). There were peaks in feces that appeared and peaks that disappeared compared with the milk sample. For example, peaks from 25–26 min found in the milk sample were diminished in the fecal sample, whereas a peak at 8.5 min appeared in the fecal chromatogram that was absent in the milk (Fig. 2).
      Figure thumbnail gr1
      Fig. 1Names and graphical representations of the different monosaccharides that compose human milk oligosaccharides (HMOs) and N-glycans. Representative branched and linear neutral and acidic HMOs and the different subclasses of N-glycans, along with their potential linkages are also depicted.
      Figure thumbnail gr2
      Fig. 2(A) Extracted compound chromatograms of a mother's breast milk oligosaccharide profile at day 24 postpartum compared with (B) her infant's fecal glycan profile at day 24 postnatal. The structure found in (A) at retention time 10.3 min is 2′FL, 13.8 min is LNT, and 14.4 min is LNnT with monosaccharides glucose (●), galactose (●), and fucose (▴), all having significantly lower (2′FL) or no abundance (LNT and LNnT) in (B). Sialylated structures found in (A) from 25–26 min show significant decrease in (B) at the same retention time.
      To confirm the identity of the intact HMOs, a previously optimized method was used to identify structures in human milk through the use of accurate masses, tandem MS, reproducible retention times, and an annotated structure library (
      • Wu S.
      • Grimm R.
      • German J.B.
      • Lebrilla C.B.
      Annotation and structural analysis of sialylated human milk oligosaccharides.
      ,
      • Wu S.
      • Tao N.
      • German J.B.
      • Grimm R.
      • Lebrilla C.B.
      Development of an annotated library of neutral human milk oligosaccharides.
      ). For example, the peak at 10.3 min (Fig. 2A) with m/z 491.18 corresponds to 2′-fucosyllactose (2′FL - structure inset). The same peak was found in feces at 10.0 min with m/z 491.19 (Fig. 2B). Another notable change was the lack of isomers lacto-N-tetraose (LNT, 13.8 min) and lacto-N-neotetraose (LNnT, 14.4 min) in the fecal sample (Fig. 2). The intact HMOs identified in breast milk and infant feces are listed in Table I, with a complete list of intact HMOs found in milk and feces in supplemental Table S1. In general, we found that many of the species transit through the gut, albeit in depleted amounts at least early in the lactation period (day 24).
      Table IIntact human milk oligosaccharides (HMOs) identified in breast milk at day 24 postpartum and her infant's feces at day 24 postnatal. The neutral mass, HMO composition given as Hex_HexNAc_Fuc_Neu5Ac, name of the HMO, volumes, and retention time are provided for the extracted HMOs based on nanoLC-MS analysis
      Present in Mother's MilkPresent in Infant's Feces
      Neutral MassCompositionNameVolumeRetention Time (min)IdentifiedVolume
      490.192_0_1_03FL399511.1X56044
      490.192_0_1_02′FL1563541910.4X1831235
      855.3223_1_1_0LNFP II354685810.6X5618447
      636.2482_0_2_0LDFT637180213.0
      1366.5124_2_2_0DFpLNH II90071413.0
      855.3223_1_1_0LNFP I+III5239529213.3X36476336
      709.2643_1_0_0LNT6308993613.8
      1512.574_2_3_0TFLNH269326414.1X3840508
      709.2643_1_0_0LNnT5510242414.4
      635.2272_0_0_16′S;L7011114.8X101752
      1220.4544_2_1_0MFpLNH IV327266615.0
      1220.4544_2_1_04120a248885415.5
      1366.5124_2_2_0DFLNHa870410815.7X63718448
      1220.4544_2_1_0MFLNH I+III10209416.6
      1220.4544_2_1_0IFLNH III624900217.6X11315122
      1074.3964_2_0_0LNH1156361017.8X3005247
      1074.3964_2_0_0LNnH1616810218.5
      1512.574_2_3_04320a211266019.1X1550701
      1366.5124_2_2_0DFLNHc276583320.1
      1220.4544_2_1_0IFLNH I292681520.2
      1074.3964_2_0_0p-LNH368791421.6X543930
      635.2272_0_0_13′S;L206752721.7X209245
      1146.4173_1_1_1F-LSTc218929422.5X550042
      1000.3593_1_0_1LSTc1169481823.7
      1000.3593_1_0_1LSTb1285252924.2X357439
      1365.4924_2_0_1S-LNH94417924.8X1208673
      1365.4924_2_0_14021a+S-LNnH II1696951325.8X909254
      1000.3593_1_0_1LSTa465852627.2X10931904
      The HMO profile of feces displays preferential consumption of select glycan species. For example, fewer sialylated compounds were identified in feces that eluted from 25 to 26 min, compared with the milk (Fig. 2). There are 30% fewer sialylated HMO structures in feces compared with milk (supplemental Table S1). However, the largest drop in the number of HMO compounds was for the undecorated structures (containing neither Fuc nor Neu5Ac), which decreased by 60% in feces (supplemental Table S1).

      Determination of Unidentified HMO and Non-HMO Species

      The non-HMO compounds present in the chromatogram were further probed to determine if they were indeed oligosaccharides. To determine these new structures, their compositions were first determined by accurate masses and confirmed by tandem MS. For example, a compound in Fig. 2B with retention time 13.6 min was found to have a neutral molecular mass of 547.21 Da, corresponding to a composition of 2Hex:1HexNAc. The tandem MS spectrum confirmed the composition (supplemental Fig. S1). Two peaks with m/z 204.09 and 366.16 were observed corresponding to HexNAc and 1Hex:1HexNAc, respectively. Also observed was a neutral loss of 162.06, because of the loss of one Hex, and 182.07, a Hex reduced to the alditol. Reduction of the glycans is incorporated in the extraction method to eliminate peak splitting during chromatographic separation because of the presence of anomers and to identify the reducing end saccharide in the tandem MS.
      Another example is illustrated with the compound found at 17.2 min (Fig. 2B). The MS yields a neutral molecular mass of 693.26 Da, which corresponds to the composition 2Hex:1HexNAc:1Fuc. The tandem MS spectrum is consistent with an oligosaccharide but was not consistent with an HMO as there were no fragments indicative of the lactose (Gal(β1–4)Glc) core, but a neutral loss of 182.08 (a reduced Hex) was present (supplemental Fig. S2). The results of these analyses are summarized in Table II with a list of the compound compositions and their respective retention times. Also listed are the potential sources of the oligosaccharides, which are either HMOs or glycoproteins as discussed below.
      Table IIExtracted oligosaccharides from infant feces. Neutral mass, composition given as Hex_HexNAc_Fuc_Neu5Ac, oligosaccharide type, volume, and retention time are provided based on nanoLC-MS and nanoLC-MS/MS analysis
      Neutral massCompositionOligosaccharide typeVolumeRetention time (min)
      750.2912_2_0_0HMO digest2796109.5
      3377.2406_6_4_2Fucosylated and sialylated complex1962269.8
      1829.6904_5_1_0Fucosylated complex/hybrid3790410.0
      1464.5603_4_1_0Fucosylated complex13825110.1
      1261.4803_3_1_0N-glycan digest54948710.8
      1407.5403_3_2_0Fucosylated complex13725910.8
      1407.5403_3_2_0Fucosylated complex15305511.5
      1204.4603_2_2_0HMO digest50255811.7
      896.34902_2_1_0HMO digest18208511.8
      1407.5403_3_2_0Fucosylated complex4954411.8
      1439.5305_3_0_0Intact HMO18415212.0
      1058.4003_2_1_0HMO digest57453812.1
      1204.4603_2_2_0HMO digest210331212.1
      1220.4504_2_1_0Intact HMO238138212.1
      1772.6704_4_2_0Fucosylated complex/Hybrid5736212.1
      2354.82011_2_1_0Fucosylated high mannose21223912.2
      1569.5904_3_2_0Fucosylated complex/hybrid20041712.3
      1843.63010_1_0_0N-glycan digest10680612.4
      1521.5803_5_0_0Complex10067212.5
      1115.4203_3_0_0HMO digest or complex/hybrid98591412.6
      1261.4803_3_1_0N-glycan digest23181612.6
      912.3433_2_0_0HMO digest189175112.9
      1058.4003_2_1_0HMO digest454912212.9
      1204.4603_2_2_0HMO digest574995212.9
      896.34902_2_1_0HMO digest12344013.0
      2178.8304_6_2_0Fucosylated complex59533413.0
      3579.3006_7_2_3Fucosylated and sialylated complex105956813.0
      1667.6403_5_1_0Fucosylated complex9454013.2
      1382.5105_2_1_0Intact HMO or fucosylated complex/hybrid4787913.3
      896.3492_2_1_0HMO digest59687013.4
      1261.4803_3_1_0N-glycan digest24084313.4
      1407.5403_3_2_0Fucosylated complex17528513.4
      547.2112_1_0_0HMO digest88132413.6
      1058.4003_2_1_0HMO digest382427013.6
      3465.2606_5_4_3Fucosylated and sialylated complex12422513.6
      1220.4504_2_1_0Intact HMO1718548613.7
      1115.4203_3_0_0HMO digest or complex/hybrid94718414.3
      1261.4803_3_1_0N-glycan digest905756114.3
      1058.4003_2_1_0HMO digest329260814.4
      1204.4603_2_2_0HMO digest128507914.4
      1569.5904_3_2_0Fucosylated complex/hybrid31499714.5
      2428.9005_5_2_1Fucosylated and sialylated complex/hybrid27309714.5
      547.2112_1_0_0HMO digest88407814.6
      912.3433_2_0_0HMO digest7188414.6
      1382.5105_2_1_0Intact HMO or fucosylated complex/hybrid382070214.6
      1991.7405_5_1_0Fucosylated complex/hybrid8366915.0
      2210.8206_6_0_0Complex20948615.0
      2194.8205_6_1_0Fucosylated complex70823615.2
      1204.4603_2_2_0HMO digest45599215.9
      1893.7006_3_2_0Fucosylated hybrid11476715.9
      1204.4603_2_2_0HMO digest61550516.1
      1934.7205_4_2_0Fucosylated complex/hybrid15727316.1
      1569.5904_3_2_0Fucosylated complex/hybrid647905216.4
      1731.6405_3_2_0Intact HMO25030616.4
      2908.1004_6_5_1Fucosylated and sialylated complex61479416.4
      1626.6104_4_1_0Fucosylated complex/hybrid98964516.5
      1261.4803_3_1_0N-glycan digest75846816.6
      912.3433_2_0_0HMO digest10860016.7
      1115.4203_3_0_0HMO digest or complex/hybrid147132616.7
      1480.5504_4_0_0Complex/Hybrid96368916.7
      1843.63010_1_0_0N-glycan digest32101216.7
      2073.8003_7_1_0Fucosylated complex207795216.7
      1261.4803_3_1_0N-glycan digest53554816.8
      1756.6703_4_3_0Fucosylated complex10976916.8
      1423.5304_3_1_0Intact HMO972819416.9
      1569.5904_3_2_0Fucosylated complex/hybrid77914916.9
      1731.6405_3_2_0Intact HMO62801816.9
      1893.7006_3_2_0Fucosylated hybrid15292917.0
      693.2692_1_1_0HMO Digest17077417.2
      4267.5427_6_5_4Fucosylated and sialylated complex70827717.2
      4121.4807_6_4_4Fucosylated and sialylated complex49118217.3
      1724.6603_6_0_0Complex17558317.6
      1714.6304_3_1_1Fucosylated and sialylated complex70562317.7
      2908.1004_6_5_1Fucosylated and sialylated complex34461717.8
      2997.1106_7_2_1Fucosylated and sialylated complex10619517.8
      1115.4203_3_0_0HMO digest or complex/hybrid128081417.9
      1626.6104_4_1_0Fucosylated complex/hybrid13794118.0
      1731.6405_3_2_0Intact HMO225049918.0
      3306.2407_7_5_0Fucosylated complex411215518.0
      1519.5308_1_0_0N-glycan digest13303318.1
      2046.72010_2_0_0High mannose10483118.4
      1439.5305_3_0_0Intact HMO120659018.5
      1585.5905_3_1_0Intact HMO965234918.5
      1683.6304_5_0_0Complex/Hybrid90057718.5
      1074.4004_2_0_0Intact HMO73650618.6
      547.2112_1_0_0HMO digest29527118.8
      1058.4003_2_1_0HMO digest28507118.8
      2354.82011_2_1_0Fucosylated high mannose73372218.8
      1731.6405_3_2_0Intact HMO649977419.0
      1626.6104_4_1_0Fucosylated complex/hybrid31716719.2
      2063.7704_4_2_1Fucosylated and sialylated complex8242819.2
      2080.7805_4_3_0Fucosylated complex/hybrid22190019.4
      2242.8306_4_3_0Intact HMO199564619.4
      1033.3705_1_0_0N-glycan digest6570519.6
      2354.82011_2_1_0Fucosylated high mannose25374519.8
      1074.4004_2_0_0Intact HMO13340820.0
      1115.4203_3_0_0HMO Digest or complex/hybrid86303020.0
      1569.5904_3_2_0Fucosylated complex/hybrid52284420.1
      2242.8306_4_3_0Intact HMO59626720.1
      2137.8005_5_2_0Fucosylated complex/hybrid35430720.3
      1407.5403_3_2_0Fucosylated complex35227920.4
      1439.5305_3_0_0Intact HMO472769420.5
      1585.5905_3_1_0Intact HMO141782920.5
      2354.82011_2_1_0Fucosylated high mannose18608120.7
      2980.0905_7_1_2Fucosylated and sialylated complex5808920.7
      750.2912_2_0_0HMO digest51479620.8
      1115.4203_3_0_0HMO digest or complex/hybrid34846820.8
      1261.4803_3_1_0N-glycan digest313183420.8
      1318.5003_4_0_0Complex27255320.8
      1480.5504_4_0_0Complex/hybrid43032020.8
      1382.5105_2_1_0Intact HMO35141920.9
      1934.7205_4_2_0Fucosylated complex/hybrid35633120.9
      1714.6304_3_1_1Fucosylated and sialylated complex75769121.0
      1788.6705_4_1_0HMO digest or fucosylated complex/hybrid8021921.0
      2957.1007_6_4_0Fucosylated complex15253021.1
      1480.5504_4_0_0Complex/Hybrid67367021.2
      1917.7104_4_1_1Fucosylated and sialylated complex6722521.2
      1439.5305_3_0_0Intact HMO37353421.4
      1480.5504_4_0_0Complex/Hybrid107486821.8
      1568.5704_3_0_1Sulfated complex12455121.8
      1788.6705_4_1_0HMO digest or fucosylated complex/hybrid15453121.8
      1934.7205_4_2_0Fucosylated complex/hybrid13269422.3
      2096.7806_4_2_0Intact HMO or fucosylated hybrid433623222.4
      2137.8005_5_2_0Fucosylated complex/hybrid48963222.6
      2615.9804_6_3_1Fucosylated and sialylated complex4930722.9
      1480.5504_4_0_0Complex/Hybrid18983923.1
      1845.6905_5_0_0Complex/Hybrid42955723.1
      1950.7206_4_1_0Intact HMO355124823.2
      2022.7405_3_2_1Intact HMO32944623.3
      1439.5305_3_0_0Intact HMO15253623.4
      1714.6304_3_1_1Fucosylated and sialylated complex38278123.4
      2210.8206_6_0_0Complex19416423.4
      2323.8704_6_1_1Fucosylated and sialylated complex4142623.5
      1585.5905_3_1_0Intact HMO94505423.6
      1480.5504_4_0_0Complex/Hybrid127531223.8
      1804.6606_4_0_0Intact HMO18845523.8
      3272.2105_7_3_2Fucosylated and sialylated complex9195123.8
      2251.8405_7_0_0Complex8362824.1
      1569.5904_3_2_0Fucosylated complex/hybrid40315124.2
      2022.7405_3_2_1Intact HMO5190124.2
      1845.6905_5_0_0Complex/Hybrid35243324.3
      1876.6805_3_1_1Intact HMO11557824.3
      2251.8405_7_0_0Complex19957024.3
      1569.5904_3_2_0Fucosylated complex/hybrid8116624.6
      1318.5003_4_0_0Complex6254325.2
      1934.7205_4_2_0Fucosylated complex/hybrid9570526.1
      1876.6805_3_1_1Intact HMO16819826.5
      1730.6205_3_0_1Intact HMO or sialylated hybrid49731826.8
      2095.7606_4_0_1Intact HMO or sialylated hybrid48188427.1
      2219.8603_7_2_0Fucosylated complex38062027.8
      1204.4603_2_2_0HMO digest4676428.0
      Oligosaccharides are not all derived from HMOs. There are structures that are consistent with N-glycans based on their fragmentation patterns. Fig. 3A shows the tandem MS spectrum of a doubly charged glycan with m/z 631.74, which corresponds to the composition 3Hex:3HexNAc:1Fuc. The loss of 111.53 correlates to a doubly charged reduced HexNAc, and the singly charged reduced HexNAc can be observed at m/z 224.10, both indicative of a reduced GlcNAc from an N-glycan core (Fig. 3A). The fragmentation pattern further suggests a fucosylated species with losses corresponding to Hex and Fuc (Fig. 3A).
      Figure thumbnail gr3
      Fig. 3Tandem mass spectra of oligosaccharides extracted from infant feces reveals they are of human milk oligosaccharide (HMO) and glycoprotein origins. Monosaccharides represented as glucose (●), galactose (●), mannose (●), N-acetylglucosamine (■), and fucose (▴). A, Doubly charged precursor ion with m/z 631.74 shows neutral losses of monosaccharides consistent with an intact N-glycan, including the reduced GlcNAc core. B, Precursor ion with m/z 1440.52 shows neutral losses of mono- and disaccharides consistent with an HMO structure. C, Precursor ion with m/z 913.35 has tandem mass spectrum pattern consistent with an HMO structure, including the lactose core.
      Tandem MS was used to differentiate between oligosaccharides derived from either HMOs or N-glycans. One example is a compound with composition 5Hex:3HexNAc at m/z 1440.52, corresponding either to an HMO or a hybrid-type N-glycan. The neutral loss of 344.11 in the tandem MS spectrum indicates a reduced lactose core of an HMO (Fig. 3B). The repeated neutral loss of 365.14 was also suggestive of the repeating lactosamine (Gal(β1–3/4)GlcNAc) units that make up the backbone of HMOs. The lack of m/z 224.11, which would have indicated a reduced GlcNAc from the chitobiose N-glycan core, was another indication that this oligosaccharide was an HMO and not an N-glycan. Fragmentation of an antenna or the trimannosyl portion of the N-glycan core would lead to subsequent neutral losses of 162.05, but neither were present.
      A more difficult example is the compound with composition 3Hex:2HexNAc (m/z 913.35), which appears to be an N-glycan core. The fragmentation showed neutral losses of 344.12, which corresponds to a reduced lactose core of an HMO (Fig. 3C). Also observed were neutral losses of 182.05, the mass of a reduced Hex, which corresponds to the reduced Glc of the lactose core (Fig. 3C). Neutral losses of 223.10 or a peak at m/z 224.11 would have been indicative of a reduced HexNAc and evidence of the N-glycan core, however these were not observed. Because these diagnostic markers were not found in the MS spectra, composition 3Hex:2HexNAc was assigned as a degraded HMO (Table II).
      There are compositions whose origins could not be differentiated between HMOs and N-glycans, even when their fragmentation patterns are known. This is because of their low abundances, which made tandem MS difficult to obtain. The masses of these overlapping compositions were added to the Fecal Glycan Library, with both oligosaccharide sources listed (Table II).

      Selection and Expression of Microbial Enzymes

      Previous analysis on the feces of these infants showed that the infants were dominated by types of bifidobacteria that are capable of catabolyzing HMOs (supplemental Fig. S3) (
      • LoCascio R.G.
      • Ninonuevo M.R.
      • Freeman S.L.
      • Sela D.A.
      • Grimm R.
      • Lebrilla C.B.
      • Mills D.A.
      • German J.B.
      Glycoprofiling of bifodobaterial consumption of human milk oligosaccharides demonstrates strain specific, preferential consumption of small chain glycans secreted in early human lactation.
      ,
      • Lewis Z.T.
      • Totten S.M.
      • Smilowitz J.T.
      • Popovic M.
      • Parker E.
      • Lemay D.G.
      • Van Tassell M.L.
      • Miller M.J.
      • Jin Y.S.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      Maternal fucosyltransferase 2 status affects the gut bifidobacterial communities of breastfed infants.
      ). For this reason, glycosidases from bifidobacterial strains were expressed to determine whether the enzymes can act on HMOs and produce the structures present in the infant feces. For this work, we selected an exogalactosidase and endoglycosidase from bifidobacteria to determine whether these acted on milk glycoconjugates. An example is illustrated in Fig. 4 with a β-galactosidase from B. longum subsp. longum SC596, BLNG_00015. For these experiments, pooled HMOs were treated with the enzyme (a galactosidase, pH 6.0 at 55 °C for 1 h). The abundances of HMOs in the digested pool were compared with those in an undigested HMO pool. The chromatograms in Fig. 4A show digestion of select structures with m/z 611.24 (4Hex:2HexNAc:1Fuc). Two isomers - monofucosyllacto-N-hexaose I (MFLNH I, retention time 14.5 min, inset structure 4) and isomer 3 fucosyl-paralacto-N-hexaose (IFLNH III, retention time 15.2 min, inset structure 5) - were noticeably lower in abundances in the digested HMO pool compared with the undigested HMO pool (Fig. 4A). Isomer 1 fucosyl-paralacto-N-hexaose (IFLNH I, retention time 18.3 min, inset structure 6), however, has no terminal Gal residue and therefore the exogalactosidase was unable to digest this structure as shown by the overlapping chromatograms (Fig. 4A). The exogalactosidase was also able to degrade select undecorated intact HMOs with m/z 1075.41 (4Hex:2HexNAc) (Fig. 4B). Lacto-N-hexaose (LNH, retention time 15.6 min, inset structure 7) and lacto-N-neohexaose (LNnH, retention time 16.2 min, inset structure 8) decreased in abundance, but para-lacto-N-hexaose (p-LNH, retention time 19.5 min, inset structure 9) went undigested (Fig. 4B).
      Figure thumbnail gr4
      Fig. 4Overlaid extracted ion chromatograms (EICs) of β-galactosidase BLNG_00015 digestion of a human milk oligosaccharide (HMO) pool (–) compared with an unreacted HMO pool (–). Monosaccharide composition of structures given as Hex_HexNAc_Fuc_Neu5Ac and represented as glucose (●), galactose (●), N-acetylglucosamine (■), and fucose (▴). A, EICs of doubly charged m/z 611.24 shows decreased abundance of specific fucosylated isomers in the reacted HMO pool (1: MFpLNH IV, 2: 4120a, 3: MFLNH III, 4: MFLNH I, 5: IFLNH III, 6: IFLNH I). B, EICs of m/z 1075.41 shows decreased abundance of specific undecorated isomers in the reacted HMO pool (7: LNH, 8: LNnH, 9: p-LNH). C, EICs of m/z 913.35 shows increased abundance of potential digestion products in the reacted HMO pool. D, EICs of m/z 751.29 shows increased abundance of the potential digestion product in the reacted HMO pool.
      After analyzing intact HMO digestion, we turned our attention to the digestion products that were formed by the exogalactosidase activity. If LNH and LNnH (4Hex:2HexNAc) were to lose a terminal Gal residue the digestion products would have the composition 3Hex:2HexNAc. This composition was seen in high abundance in the digested sample (Fig. 4C). Further digestion would lead to the loss of another terminal Gal and composition 2Hex:2HexNAc (Fig. 4D). The abundance in the undigested pool was at baseline for these digestion products, revealing that they are not found as intact HMO structures in the pooled breast milk but were only observed after performing enzymatic digestion reactions. These new digested HMO products were added to the Fecal Glycan Library (supplemental Table S2).
      An endoglycosidase from B. longum subsp. infantis was previously expressed to determine its activity. Instead of degrading HMOs, this enzyme (EndoBI-1) was active on N-glycans, demonstrating preferential cleavage between the two GlcNAcs of the chitobiose core (
      • Garrido D.
      • Nwosu C.
      • Ruiz-Moyano S.
      • Aldredge D.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      Endo-β-N-acetylglucosaminidases from infant gut-associated bifidobacteria release complex N-glycans from human milk glycoproteins.
      ). These types of degraded N-glycans were observed in feces. For example, the m/z 1034.37 peak detected in feces corresponds to an oligosaccharide with composition 5Hex:1HexNAc (fragmentation shown in Fig. 5). This composition is not consistent with an intact or digested HMO for several reasons. Large HMO structures have repeating lactosamine units, and this compound only has one HexNAc. The tandem MS yields a peak at m/z 224.11, consistent with a reduced HexNAc, which is a rare occurrence in HMOs (Fig. 5). All the neutral mass losses that led up to that peak were 162, indicative of Hex losses, most likely mannose residues (Fig. 5). Because of the reduced GlcNAc and the five successive Hex, we deduced that this oligosaccharide is indeed a high mannose type N-glycan cleaved by an endoglycosidase. Both intact and digested N-glycans, their masses, and corresponding compositions were also added to the Fecal Glycan Library (supplemental Table S2).
      Figure thumbnail gr5
      Fig. 5Oligosaccharide extracted in infant feces was determined to be a degraded N-glycan based on tandem mass spectra. Monosaccharides represented as mannose (●) and N-acetylglucosamine (GlcNAc) (■). Precursor ion with m/z 1034.37 shows neutral subsequent losses of hexose residues consistent with a high mannose type N-glycan. Only one GlcNAc present in the core is indicative of endoglycosidase activity on the glycoprotein this structure was derived from.

      Observation of Infant Fecal Glycome and Microbiome Profile Changes Postnatal

      The compilation of fecal glycans (the Fecal Glycan Library) with their retention times and accurate masses were used to determine the fecal glycome profiles of infants over lactation. Fecal samples for three of the infants from the Davis Lactation Study were analyzed at several postnatal time points. For all three infants, there was a drastic decrease in the abundance of intact HMO from the first week of life (days 6 and 7) to week 17 (day 120) (Fig. 6). The absolute abundance dropped 75.3% on average, also observed was an opposite trend for digested HMO over lactation, which increased 124.0% at week 17 (Fig. 6). The bacterial profiling revealed that bifidobacteria, known to consume HMOs comprised on average 68.0% of all bacteria in the infant gut at week 17 (Supplemental Fig. 3) (

      German, J. B., Freeman, S. L., Lebrilla, C. B., and Mills, D. A., (2007) Human Milk Oligosaccharides: Evolution, Structures, and Bioselectivity as Substrates for Intestinal Bacteria. In: Bier, D. M., German, J. B., and B., L., eds. 62nd Nestle Nutrition Workshop, Pediatric Program, pp. 205–222, Helsinki, Finland.

      ,
      • Ward R.E.
      • Ninonuevo M.R.
      • Mills D.A.
      • Lebrilla C.B.
      • German J.B.
      In vitro fermentation of breast milk oligosaccharides by Bifidobacterium infantis and Lactobacillus gasseri.
      ). For two of the infants, (1004 and 1054) the abundance of digested N-glycans also increased from week 1 to week 17 (Fig. 6). B. longum subsp. longum comprised 9.8% of all bacteria in the infant 1054 fecal microbiota at week 17 (supplemental Table S3). Schell et al. showed that B. longum contains a genomic cluster with an endoglycosidase for cleaving GlcNAcs which explains our observance of digested N-glycans (
      • Schell M.A.
      • Karmirantzou M.
      • Snel B.
      • Vilanova D.
      • Berger B.
      • Pessi G.
      • Zwahlen M-C
      • Desiere F.
      • Bork P.
      • Delley M.
      • Pridmore R.D.
      • Arigoni F.
      The genome sequence of Bifidobacterium longum reflets its adaptation to the human gastrointestinal tract.
      ). B. longum subsp. infantis, known to catabolize the entire HMO internally, was found to comprise 6.7% and 4.2% of all bacteria in infant 1040 at weeks 3 and 17, respectively (supplemental Fig. S3) (
      • LoCascio R.G.
      • Ninonuevo M.R.
      • Kronewitter S.R.
      • Freeman S.L.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      A versatile and scalable strategy for glycoprofiling bifidobacterial consumption of human milk oligosaccharides.
      ,
      • Sela D.A.
      • Mills D.A.
      Nursing our microbiota: molecular linkages between bifidobacteria and milk oligosaccharides.
      ). This correlated with lower amounts of digested HMOs at those time points (Fig. 6). This trend is consistent with the gut microbiota becoming established, niches being filled, and more of the oligosaccharides being degraded later in lactation.
      Figure thumbnail gr6
      Fig. 6Changes in three infant fecal glycan and bifidobacteria profiles for 1, 3, 10, and/or 17 weeks postnatal. Bar graphs represent absolute abundances of the different glycan types (intact HMOs (■), digested HMOs (■), intact N-glycans (■), digested N-glycans (■), and indistinguishable glycans with overlapping compositions (■)), as well as relative abundances of bifidobacterial subspecies (B. breve (■), B. longum subsp. longum (■), B. longum subsp. infantis (■), and B. pseudocatenulatum (■)) in relation to the entire microbiota. Large decrease in intact HMOs for all infants from week 1 to week 17, along with an increase in digested HMOs in that same time frame. Infants 1004 and 1054 also showed an increase in digested N-glycans from week 1 to 17. Intact HMOs and bifidobacterial species display inverse relationship, with increase in relative abundance of bifidobacteria from week 1 to week 17 for infants 1004 and 1040. *Relative abundances of bifidobacteria were <1% at weeks 1 and 10 for infant 1004.

      DISCUSSION

      Human breast milk contains both free and bound oligosaccharides. As the infant consumes breast milk, the contents pass through the digestive tract through the intestine, where they encounter the gut microbiota. The bacteria are equipped with glycosidases that cleave HMOs and other glycoconjugates, potentially leaving digestion products and free oligosaccharides to pass through the gut and exit as feces. Glycoconjugates such as N-glycans may be degraded while still linked to proteins, but they can also be enzymatically released from glycoproteins to form new free oligosaccharides. After their release, free N-glycans can be further degraded by exoglycosidases to form additional digestion products. Our oligosaccharide enrichment method may also extract O-glycans. In vitro studies have shown bacterial growth on, binding to, and degradation of mucus O-glycans, yet no glycosidases have been characterized that can release large O-glycans (larger than disaccharides) from glycoproteins (
      • Koropatkin N.M.
      • Cameron E.A.
      • Martens E.C.
      4) How glycan metabolism shapes the human gut microbiota.
      ,
      • Martens E.C.
      • Chiang H.C.
      • Gordon J.I.
      Mucosal glycan foraging enhances fitness and transmission of a saccharolytic human gut bacterial symbiont.
      ,
      • Tailford L.E.
      • Crost E.H.
      • Kavanaugh D.
      • Juge N.
      Mucin glycan foraging in the human gut microbiome.
      ,
      • Marcobal A.
      • Southwick A.M.
      • Earle K.A.
      • Sonnenburg J.L.
      A refined palate: Bacterial consumption of host glycans in the gut.
      ). Furthermore, O-glycans are in much lower abundances in milk compared with HMOs and N-glycans and are therefore not expected to be present in appreciable abundances (
      • Schulz B.L.
      • Packer N.H.
      • Karlsson N.G.
      Small-scale analysis of O-linked oligosaccharides from glycoproteins and mucins separated by gel electrophoresis.
      ,
      • Royle L.
      • Mattu T.S.
      • Hart E.
      • Langridge J.I.
      • Merry A.H.
      • Murphy N.
      • Harvey D.J.
      • Dwek R.A.
      • Rudd P.M.
      An analytical and structural database provides a strategy for sequencing O-Glycans from microgram quantities of glycoproteins.
      ). Free oligosaccharides may also be released from glycolipids (
      • Lee H.
      • Garrido D.
      • Mills D.A.
      • Barile D.
      Hydrolysis of milk gangliosides by infant-gut associated bifidobacteria determined by microfluidic chips and high-resolution mass spectrometry.
      ), yet much like O-glycans, glycolipids are far less abundant compared with HMOs and N-glycosylated proteins and are not likely to be observed. In order to identify structures that are digestion products of HMOs, enzymatic in vitro experiments were performed. One involved the use of an exogalactosidase (BLNG_00015) from B. longum subsp. longum SC596, as this species was found in high abundance in the infant fecal samples. Digestion of intact HMOs showed that the enzyme was capable of degrading structures with a terminal galactose residue, but more interesting were the structures not degraded. The lack of digestion for p-LNH is explained by the preference for β(1–4)Gal linkages of this specific enzyme. Both LNH and LNnH have at least one terminal β(1–4)Gal so those isomers were digested, but because p-LNH only has a terminal β(1–3)Gal linkage, the hydrolase was unable to cleave the linkage leaving the structure intact. This specificity was also observed in the fucosylated structures MFLNH I and IFLNH III, which both contain a terminal β(1–4)Gal residue so the exogalactosidase was capable of degrading those structures. Having a Fuc present on the same GlcNAc as a β(1–4)Gal appeared to hinder the enzyme from hydrolyzing that linkage. This type of analysis reveals the specificity of microbial enzymes. Observance of certain isomers, along with the absence of others, can indicate the preferences of those enzymes present. These experiments also confirmed that degraded oligosaccharides obtained in infant feces can be produced under in vitro conditions with the appropriate enzymes.
      It was not surprising to find intact N-glycans in the infant feces at all sampled time points, as these molecules have been described in breast milk. The observation of degraded N-glycans in vivo in infant feces is, however, a novel finding. Degradation of N-glycans has been predicted before by enzymatic studies of individual microbes. For example, Bacteroides is known to inhabit breast-fed infant digestive tracts, was found in the feces of the infants in this study, and is known to have an enzyme capable of cleaving intact N-glycans from glycoproteins (
      • Marcobal A.
      • Sonnenburg J.L.
      Human milk oligosaccharide consumption by intestinal microbiota.
      ,
      • Lewis Z.T.
      • Totten S.M.
      • Smilowitz J.T.
      • Popovic M.
      • Parker E.
      • Lemay D.G.
      • Van Tassell M.L.
      • Miller M.J.
      • Jin Y.S.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      Maternal fucosyltransferase 2 status affects the gut bifidobacterial communities of breastfed infants.
      ,
      • Macfarlane G.T.
      • Gibson G.R.
      Formation of glycoprotein degrding enzymes by Bacteroides fragilis.
      ). Another enzyme, Peptide:N-glycosidase F (PNGase F), is known to cleave N-glycans at the glycosylamine linkage, but this enzyme was discovered in the pathogenic bacterium Flavobacterium meningosepticum (
      • Plummer T.H.J.
      • Elder J.H.
      • Alexander S.
      • Phelan A.W.
      • Tarentino A.L.
      Demonstration of Peptide:N-Glycosidase F Activity in Endo-β-N-acetylglucosaminidase F Preparations.
      ,
      • Tarentino A.L.
      • Gomez C.M.
      • Plummer T.H.J.
      Deglycosylation of asparagine-linked glycans by peptide:N-glycosidase F.
      ). Experiments were not performed in this study using this specific enzyme because of its widely established activity on glycoproteins. Although F. meningosepticum was not specifically detected in the feces of the infants, it is a potential glycoprotein degrader and contributor to intact N-glycans in feces. Other N-glycans observed were hydrolyzed at the chitobiose core. We previously discovered an endoglycosidase, EndoBI-1, in B. longum subsp. infantis that was able to release all types of N-glycans from lactoferrin and immunoglobulins A and G by cleaving the oligosaccharide between the two core GlcNAcs, which is consistent with the product found in feces and may explain other similar digested N-glycan products (
      • Garrido D.
      • Nwosu C.
      • Ruiz-Moyano S.
      • Aldredge D.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      Endo-β-N-acetylglucosaminidases from infant gut-associated bifidobacteria release complex N-glycans from human milk glycoproteins.
      ). B. longum was found in all infants (B. longum subsp. infantis and B. longum subsp. longum), and one strain of B. longum was also found to contain genes for an endoglycosidase (
      • Schell M.A.
      • Karmirantzou M.
      • Snel B.
      • Vilanova D.
      • Berger B.
      • Pessi G.
      • Zwahlen M-C
      • Desiere F.
      • Bork P.
      • Delley M.
      • Pridmore R.D.
      • Arigoni F.
      The genome sequence of Bifidobacterium longum reflets its adaptation to the human gastrointestinal tract.
      ). Endoglycosidases have also been found in other bifidobacteria species, along with Streptomyces plicatus, and pathogenic Enterococcus faecalis, Streptococcus pyogenes, and Streptococcus pneumoniae (
      • Garrido D.
      • Nwosu C.
      • Ruiz-Moyano S.
      • Aldredge D.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      Endo-β-N-acetylglucosaminidases from infant gut-associated bifidobacteria release complex N-glycans from human milk glycoproteins.
      ,
      • Muramatsu H.
      • Tachikui H.
      • Ushida H.
      • Song X-j
      • Qiu Y.
      • Yamamoto S.
      • Muramatsu T.
      Molecular cloning and expression of endo-β-N-acetylglucosaminidase D, which acts on the core structure of complex type asparagine-linked oligosaccharides.
      ,
      • Trimble R.B.
      • Maley F.
      The use of endo-β-N-acetylglucosaminidase H in characterizing the structure and function of glycoproteins.
      ,
      • Collin M.
      • Fischetti V.A.
      A novel secreted endoglycosidase from Enterococcus faecalis with activity on human immunoglobulin G and ribonuclease B.
      ,
      • Allhorn M.
      • Olin A.I.
      • Nimmerjahn F.
      • Collin M.
      Human IgG/FcψR interactions are modulated by streptococcal IgG glycan hydrolysis.
      ). These studies employed genetic analysis and in vitro experiments to determine the enzyme's activity, but did not test their in vivo implications.
      Fecal glycan profile changes were observed for infants postnatally. There was an initial increase in total oligosaccharide abundance for infants 1004 and 1054, but not for infant 1040. This initial increase with a later decrease has been observed previously (
      • De Leoz M.L.
      • Kalanetra K.M.
      • Bokulich N.A.
      • Strum J.S.
      • Underwood M.A.
      • German J.B.
      • Mills D.A.
      • Lebrilla C.B.
      Human milk glycomics and gut microbial genomics in infant feces show a correlation between human milk oligosaccharides and gut microbiota: a proof-of-concept study.
      ), and has been attributed to the initial lack of saccharolytic bacteria. The HMOs accumulate until the establishment of HMO-consuming microbiota in the infant's gut. This process of maturation occurs at different rates for infants, however, the general trend is that the HMOs decrease. There is a drastic decrease in intact HMOs from week 1 to week 17 postpartum for all three infants, as well as an increase in digested HMOs. It has been shown that the abundance of HMOs in breast milk decrease over the course of lactation, which could explain the diminished abundance of observed intact HMOs in infant feces (
      • Coppa G.V.
      • Gabrielli O.
      • Pierani P.
      • Catassi C.
      • Carlucci A.
      • Giorgi P.
      Changes in carbohydrate composition in human milk over 4 months of lactation.
      ). However, infants consume more volume and feed more frequently as they age before solid foods are introduced. Although the mother may be producing milk with a lower concentration of oligosaccharides, the infant could still be consuming the same amount of HMOs because of the increased milk intake. We also observed an increase in bifidobacterial abundance in the infants' gastrointestinal tracts, and bifidobacteria are known to consume HMOs (

      German, J. B., Freeman, S. L., Lebrilla, C. B., and Mills, D. A., (2007) Human Milk Oligosaccharides: Evolution, Structures, and Bioselectivity as Substrates for Intestinal Bacteria. In: Bier, D. M., German, J. B., and B., L., eds. 62nd Nestle Nutrition Workshop, Pediatric Program, pp. 205–222, Helsinki, Finland.

      ,
      • Ward R.E.
      • Ninonuevo M.R.
      • Mills D.A.
      • Lebrilla C.B.
      • German J.B.
      In vitro fermentation of breast milk oligosaccharides by Bifidobacterium infantis and Lactobacillus gasseri.
      ). This suggests that the decrease in intact HMOs and increase in digested HMOs is because of bacterial metabolism. An interesting correlation was observed, however, in infant 1040, whose feces contained decreased amounts of digested HMOs during weeks 3 and 17, but also a presence of B. longum subsp. infantis at those same time points. B. longum subsp. infantis is unique among saccharolytic bacteria in that it imports the entire HMO structure for complete internal catabolism. This process could explain the low amounts of HMO digestion products in feces during later weeks (
      • LoCascio R.G.
      • Ninonuevo M.R.
      • Kronewitter S.R.
      • Freeman S.L.
      • German J.B.
      • Lebrilla C.B.
      • Mills D.A.
      A versatile and scalable strategy for glycoprofiling bifidobacterial consumption of human milk oligosaccharides.
      ,
      • Sela D.A.
      • Mills D.A.
      Nursing our microbiota: molecular linkages between bifidobacteria and milk oligosaccharides.
      ). Even though the microbiota community becomes dominated by bifidobacteria over the postnatal period leading to fewer intact HMOs and more digested HMOs in infant feces, it appears that specific strains can have an impact as to the types of fecal oligosaccharides observed. Analysis of fecal oligosaccharides has the potential of becoming a noninvasive method of assaying biomarkers likely relevant to the health of an infant (
      • Frese S.A.
      • Mills D.A.
      Should infants cry over spilled milk? Fecal glycomics as an indicator of a healthy infant gut microbiome.
      ).
      Analyzing which milk glycans remain intact in the feces of an infant can help provide insight into the types of bacteria present in the infant gut microbiome and the functions they provide. We observed HMO and bacterial interaction by directly comparing a mother's HMO composition to the oligosaccharide profile of her infant's feces. Many of the HMOs passed through intact in the feces, but in significantly depleted amounts. The two most abundant structures in breast milk, LNT and LNnT, were completely lacking from the feces, showing preferential consumption of those structures. Some HMOs were found in larger abundance in feces compared with milk, would could be attributed to large HMOs being digested to form smaller HMOs, adding to their abundance. These types of observations can allude to the interactions between microbiota and oligosaccharides. Large-scale functional characterization of the different types of bacteria in the infant's gastrointestinal tract is typically performed via metagenomic, proteomic, or metabolomic experiments. Here, we propose that fecal glycans are suggestive of the bacterial enzymes present in an infant's gut. This information allows greater understanding of how bacteria interact with HMOs and other glycoconjugates in the gut. Interestingly, a small number of select enzymes can account for the vast majority of the products, although the glycosidases may come from different strains and still represent different catabolic activities. Although additional work is still needed to describe all the relevant microbial enzymes and their specificities, we have shown that a glycan-centered analysis can provide information about the active glycosidases operating on human milk.

      REFERENCES

        • Ruhaak L.R.
        • Lebrilla C.B.
        Analysis and role of oligosaccharides in milk.
        BMB Reports. 2012; 45: 442-451
        • Nwosu C.C.
        • Aldredge D.L.
        • Lee H.
        • Lerno L.A.
        • Zivkovic A.M.
        • German J.B.
        • Lebrilla C.B.
        Comparison of the human and bovine milk N-Glycome via high-performance microfluidic chip liquid chromatography and tandem mass spectrometry.
        J. Proteome Res. 2012; 11: 2912-2924
        • Liao Y.
        • Alvarado R.
        • Phinney B.
        • Lonnerdal B.
        Proteomic characterization of human milk whey proteins during a twelve-month lactation period.
        J. Proteome Res. 2011; 10: 1746-1754
        • Bode L.
        Human milk oligosaccharides: Every baby needs a sugar mama.
        Glycobiology. 2012; 22: 1147-1162
        • Kunz C.
        • Rudloff S.
        Biological functions of oligosaccharides in human milk.
        Acta Paediatr. 1993; 82: 903-912
        • Newburg D.S.
        • Ruiz-Palacios G.
        • Morrow A.L.
        Human Milk Glycans Protect Infants Against Enteric Pathogens.
        Annu. Rev. Nutr. 2005; 25: 37-58
        • Wu S.
        • Grimm R.
        • German J.B.
        • Lebrilla C.B.
        Annotation and structural analysis of sialylated human milk oligosaccharides.
        J. Proteome Res. 2011; 10: 856-868
        • Wu S.
        • Tao N.
        • German J.B.
        • Grimm R.
        • Lebrilla C.B.
        Development of an annotated library of neutral human milk oligosaccharides.
        J. Proteome Res. 2010; 9: 4138-4151
        • Marino K.
        • Lane J.A.
        • Abrahams J.L.
        • Struew W.B.
        • Harvey D.J.
        • Marotta M.
        • Hickey R.M.
        • Rudd P.M.
        Method for milk oligosaccharide profiling by 2-aminobenzamide labeling and hydrophilic interaction chromatography.
        Glycobiology. 2011; 21: 1317-1330
        • Kobata A.
        Structures and application of oligosaccharides in human milk.
        Proc. Japan Acad., Series B. 2010; 86: 731-747
        • Thurl S.
        • Henker J.
        • Siegel M.
        • Tovar K.
        • Sawatzki G.
        Detection of four human milk groups with respect to Lewis blood group dependent oligosaccharides.
        Glycoconjugate J. 1997; 14: 795-799
        • Kunz C.
        • Rudloff S.
        • Baier W.
        • Klein N.
        • Strobel S.
        Oligosaccharides in Human Milk: Structural, Functional, and Metabolic Aspects.
        Annu. Rev. Nutr. 2000; 20: 699-722
        • Urashima T.
        • Kitaoka M.
        • Asakuma S.
        • Messer M.
        Milk Oligosaccharides.
        in: McSweeney P. Fox P. Advanced Dairy Chemistry: Lactose, Water, Salts, and Minor Constituents. Springer Science, New York, NY2009: 295-348
        • Engfer M.B.
        • Stahl B.
        • Finke B.
        • Sawatzki G.
        • Daniel H.
        Human milk oligosaccharides are resistant to enzymatic hydrolysis in the upper gastrointestinal tract.
        Am. J. Clin. Nutrition. 2000; 71: 1589-1596
        • Chaturvedi P.
        • Warren C.D.
        • Buescher C.R.
        • Pickering L.K.
        • Newburg D.S.
        Survival of human milk oligosaccharides in the intestine of infants.
        Adv. Exp. Med. Biol. 2001; 501: 315-323
        • Coppa G.V.
        • Pierani P.
        • Zampini L.
        • Bruni S.
        • Carloni I.
        • Gabrielli O.
        Characterization of oligosaccharides in milk and feces of breast-fed infants by high-performance anion-exchange chromatography.
        Adv. Exp. Med. Biol. 2001; 501: 307-314
        • Arora T.
        • Sharma R.
        Fermentation potential of the gut microbiome: implications for energy homeostasis and weight management.
        Nutrition Rev. 2010; 69: 99-106
        • Macfarlane S.
        • Macfarlane G.T.
        Regulations of short-chain fatty acid production.
        The 7th International VahounyFibre Symposium. 2003; (Edinburgh, Scotland): 67-72
        • Marcobal A.
        • Sonnenburg J.L.
        Human milk oligosaccharide consumption by intestinal microbiota.
        Clin. Microbiol. Infect. 2012; 18: 12-15
      1. German, J. B., Freeman, S. L., Lebrilla, C. B., and Mills, D. A., (2007) Human Milk Oligosaccharides: Evolution, Structures, and Bioselectivity as Substrates for Intestinal Bacteria. In: Bier, D. M., German, J. B., and B., L., eds. 62nd Nestle Nutrition Workshop, Pediatric Program, pp. 205–222, Helsinki, Finland.

        • Ward R.E.
        • Ninonuevo M.R.
        • Mills D.A.
        • Lebrilla C.B.
        • German J.B.
        In vitro fermentation of breast milk oligosaccharides by Bifidobacterium infantis and Lactobacillus gasseri.
        Appl. Environmental Microbiol. 2006; 72: 4497-4499
        • Murphy E.
        • Murphy C.
        • O'Mahony L.
        Influence of the Gut Microbiota with Ageing.
        in: Percival S.L. Microbiology and Aging: Clinical Manifestations. Springer Science+Business Media, LLC, New York, NY2007: 161
        • Garrido D.
        • Dallas D.C.
        • Mills D.A.
        Consumption of human milk glycoconjugates by infant-associated bifidobacteria: mechanisms and implications.
        Microbiology. 2013; 159: 649-664
        • LoCascio R.G.
        • Ninonuevo M.R.
        • Freeman S.L.
        • Sela D.A.
        • Grimm R.
        • Lebrilla C.B.
        • Mills D.A.
        • German J.B.
        Glycoprofiling of bifodobaterial consumption of human milk oligosaccharides demonstrates strain specific, preferential consumption of small chain glycans secreted in early human lactation.
        J. Agricultural Food Chem. 2007; 55: 8914-8919
        • Albrecht S.
        • Schols H.A.
        • van den Heuvel E.G.H.M.
        • Voragen A.G.J.
        • Gruppen H.
        Occurrence of oligosaccharides in feces of breast-fed babies in their first six months of life and the corresponding breast milk.
        Carbohydrate Res. 2011; 346: 2540-2550
        • De Leoz M.L.A.
        • Wu S.
        • Strum J.S.
        • Ninonuevo M.R.
        • Gaerlan S.C.
        • Mirmiran M.
        • German J.B.
        • Mills D.A.
        • Lebrilla C.B.
        • Underwood M.A.
        A quantitative and comprehensive method to analyze human milk oligosaccharide structures in the urine and feces of infants.
        Anal. Bioanal. Chem. 2013; 405: 4089-4105
        • Eilam O.
        • Zarecki R.
        • Oberhardt M.
        • Ursell L.K.
        • Kupiec M.
        • Knight R.
        • Gophna U.
        • Ruppin E.
        Glycan Degradation (GlyDeR) Analysis predicts mammalian gut microbiota abundance and host diet-specific adaptations.
        mBio. 2014; 5: 1-12
        • Asakuma S.
        • Hatakeyama E.
        • Urashima T.
        • Yoshida E.
        • Katayama T.
        • Yamamoto K.
        • Kumagai H.
        • Ashida H.
        • Hirose J.
        • Kitaoka M.
        Physiology of consumption of human milk oligosaccharides by infant gut-associated Bifidobacteria.
        J. Biol. Chem. 2011; 286: 34583-34592
        • LoCascio R.G.
        • Ninonuevo M.R.
        • Kronewitter S.R.
        • Freeman S.L.
        • German J.B.
        • Lebrilla C.B.
        • Mills D.A.
        A versatile and scalable strategy for glycoprofiling bifidobacterial consumption of human milk oligosaccharides.
        Microb. Biotechnol. 2009; 2: 333-342
        • Sela D.A.
        • Mills D.A.
        Nursing our microbiota: molecular linkages between bifidobacteria and milk oligosaccharides.
        Trends Microbiol. 2010; 18: 298-307
        • Lewis Z.T.
        • Totten S.M.
        • Smilowitz J.T.
        • Popovic M.
        • Parker E.
        • Lemay D.G.
        • Van Tassell M.L.
        • Miller M.J.
        • Jin Y.S.
        • German J.B.
        • Lebrilla C.B.
        • Mills D.A.
        Maternal fucosyltransferase 2 status affects the gut bifidobacterial communities of breastfed infants.
        Microbiome. 2015; 3: 13
        • Ferris A.M.
        • Jensen R.G.
        Lipids in Human Milk: A Review. 1: Sampling, determination, and content.
        J. Ped. Gastroenterol. Nutrition. 1984; 3: 108-122
        • Totten S.M.
        • Wu L.D.
        • Parker E.A.
        • Davis J.C.C.
        • Hua S.
        • Stroble C.
        • Ruhaak L.R.
        • Smilowitz J.T.
        • German J.B.
        • Lebrilla C.B.
        Rapid-throughput glycomics applied to human milk oligosaccharide profiling for large human studies.
        Anal. Bioanal. Chem. 2014; 406: 7925-7935
        • Vizcaino J.A.
        • SCsordas A.
        • del-Toro N.
        • Dianes J.A.
        • Griss J.
        • Lavidas I.
        • Mayer G.
        • Perez-Riverol Y.
        • Reisinger F.
        • Ternent T.
        • Xu Q.W.
        • Wang R.
        • Hermjakob H.
        2016 update of the PRIDE database and related tools.
        Nucleic Acids Res. 2016; 44: D447-D456
        • Lewis Z.T.
        • Bokulich N.A.
        • Kalanetra K.M.
        • Ruiz-Moyano S.
        • Underwood M.A.
        • Mills D.A.
        Use of bifidobacterial specific terminal restriction fragment length polymorphisms to complement next generation sequence profiling of infant gut communities.
        Anaerobe. 2013; 19: 62-69
        • Lewis Z.T.
        • Shani G.
        • Masarweh C.F.
        • Popovic M.
        • Frese S.A.
        • Sela D.A.
        • Underwood M.A.
        • Mills D.A.
        Validating bifidobacterial species and subspecies identity in commercial probiotic products.
        Pediatr Res. 2015; 79: 445-452
        • Caporaso J.G.
        • Lauber C.L.
        • Walters W.A.
        • Berg-Lyons D.
        • Lozupone C.A.
        • Turnbaugh P.J.
        • Fierer N.
        • Knight R.
        Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.
        Proc. Natl. Acad. Sci. U.S.A. 2011; 108: 4516-4522
        • Caporaso J.G.
        • Kuczynski J.
        • Stombaugh J.
        • Bittinger K.
        • Bushman F.D.
        • Costello E.K.
        • Fierer N.
        • Pena A.G.
        • Goodrich J.K.
        • Gordon J.I.
        • Huttley G.A.
        • Kelley S.T.
        • Knights D.
        • Koenig J.E.
        • Ley R.E.
        • Lozupone C.A.
        • Mcdonals D.
        • Muegge B.D.
        • Pirrung M.
        • Reeder J.
        • Sevindsky J.R.
        • Turnbugh P.J.
        • Walters W.A.
        • Widmann J.
        • Yatsunenko T.
        • Zaneveld J.
        • Knight R.
        QIIME allows analysis of high- throughput community sequencing data.
        Nat. Methods. 2010; 7: 335-336
        • Edgar R.C.
        Search and clustering orders of magnitude faster than BLAST.
        Bioinformatics. 2010; 26: 2460-2461
        • Wang Q.
        • Garrity G.M.
        • Tiedje J.M.
        • Cole J.R.
        Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.
        Appl. Environ. Microbiol. 2007; 73: 5261-5267
        • Cole J.R.
        • Wang Q.
        • Cardenas E.
        • Fish J.
        • Chai B.
        • Farris R.J.
        • Kulam-Syed-Mohideen A.S.
        • McGarrell D.M.
        • Marsh T.
        • Garrity G.M.
        • Tiedje J.M.
        The Ribosomal Database Project: improved alignments and new tools for rRNA analysis.
        Nucleic Acids Res. 2009; 37: D141-D145
        • DeSantis T.Z.
        • Hugenholtz P.
        • Larsen N.
        • Rojas M.
        • Brodie E.L.
        • Keller K.
        • Huber T.
        • Dalevi D.
        • Hu P.
        • Andersen G.L.
        Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.
        Appl. Environmental Microbiol. 2006; 72: 5069-5072
        • Caporaso J.G.
        • Bittinger K.
        • Bushman F.D.
        • DeSantis T.Z.
        • Andersen G.L.
        • Knight R.
        PyNAST: a flexible tool for aligning sequences to a template alignment.
        Bioinformatics. 2010; 26: 266-267
        • Garrido D.
        • Nwosu C.
        • Ruiz-Moyano S.
        • Aldredge D.
        • German J.B.
        • Lebrilla C.B.
        • Mills D.A.
        Endo-β-N-acetylglucosaminidases from infant gut-associated bifidobacteria release complex N-glycans from human milk glycoproteins.
        Mol. Cell Proteomics. 2012; 11: 775-785
        • Schell M.A.
        • Karmirantzou M.
        • Snel B.
        • Vilanova D.
        • Berger B.
        • Pessi G.
        • Zwahlen M-C
        • Desiere F.
        • Bork P.
        • Delley M.
        • Pridmore R.D.
        • Arigoni F.
        The genome sequence of Bifidobacterium longum reflets its adaptation to the human gastrointestinal tract.
        Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 14422-14427
        • Koropatkin N.M.
        • Cameron E.A.
        • Martens E.C.
        4) How glycan metabolism shapes the human gut microbiota.
        Natl. Rev. Microbiol. 2001; 10: 323-335
        • Martens E.C.
        • Chiang H.C.
        • Gordon J.I.
        Mucosal glycan foraging enhances fitness and transmission of a saccharolytic human gut bacterial symbiont.
        Cell Host Microbe. 2008; 4: 447-457
        • Tailford L.E.
        • Crost E.H.
        • Kavanaugh D.
        • Juge N.
        Mucin glycan foraging in the human gut microbiome.
        Front. Genetics. 2015; 6: 1-18
        • Marcobal A.
        • Southwick A.M.
        • Earle K.A.
        • Sonnenburg J.L.
        A refined palate: Bacterial consumption of host glycans in the gut.
        Glycobiology. 2013; 23: 1038-1046
        • Schulz B.L.
        • Packer N.H.
        • Karlsson N.G.
        Small-scale analysis of O-linked oligosaccharides from glycoproteins and mucins separated by gel electrophoresis.
        Anal. Chem. 2002; 74: 6088-6097
        • Royle L.
        • Mattu T.S.
        • Hart E.
        • Langridge J.I.
        • Merry A.H.
        • Murphy N.
        • Harvey D.J.
        • Dwek R.A.
        • Rudd P.M.
        An analytical and structural database provides a strategy for sequencing O-Glycans from microgram quantities of glycoproteins.
        Anal. Biochem. 2002; 304: 70-90
        • Lee H.
        • Garrido D.
        • Mills D.A.
        • Barile D.
        Hydrolysis of milk gangliosides by infant-gut associated bifidobacteria determined by microfluidic chips and high-resolution mass spectrometry.
        Electrophoresis. 2014; 35: 1742-1750
        • Macfarlane G.T.
        • Gibson G.R.
        Formation of glycoprotein degrding enzymes by Bacteroides fragilis.
        FEMS Microbiology Letters. 1991; 77: 289-294
        • Plummer T.H.J.
        • Elder J.H.
        • Alexander S.
        • Phelan A.W.
        • Tarentino A.L.
        Demonstration of Peptide:N-Glycosidase F Activity in Endo-β-N-acetylglucosaminidase F Preparations.
        J. Biol. Chem. 1984; 259: 10700-10704
        • Tarentino A.L.
        • Gomez C.M.
        • Plummer T.H.J.
        Deglycosylation of asparagine-linked glycans by peptide:N-glycosidase F.
        Biochemistry. 1985; 24: 4665-4671
        • Muramatsu H.
        • Tachikui H.
        • Ushida H.
        • Song X-j
        • Qiu Y.
        • Yamamoto S.
        • Muramatsu T.
        Molecular cloning and expression of endo-β-N-acetylglucosaminidase D, which acts on the core structure of complex type asparagine-linked oligosaccharides.
        J. Biochem. 2001; 129: 923-928
        • Trimble R.B.
        • Maley F.
        The use of endo-β-N-acetylglucosaminidase H in characterizing the structure and function of glycoproteins.
        Biochem. Biophys. Res. Commun. 1977; 78: 935-944
        • Collin M.
        • Fischetti V.A.
        A novel secreted endoglycosidase from Enterococcus faecalis with activity on human immunoglobulin G and ribonuclease B.
        J. Biol. Chem. 2004; 279: 22558-22570
        • Allhorn M.
        • Olin A.I.
        • Nimmerjahn F.
        • Collin M.
        Human IgG/FcψR interactions are modulated by streptococcal IgG glycan hydrolysis.
        PLoS ONE. 2008; 3: e1413
        • De Leoz M.L.
        • Kalanetra K.M.
        • Bokulich N.A.
        • Strum J.S.
        • Underwood M.A.
        • German J.B.
        • Mills D.A.
        • Lebrilla C.B.
        Human milk glycomics and gut microbial genomics in infant feces show a correlation between human milk oligosaccharides and gut microbiota: a proof-of-concept study.
        J. Proteome Res. 2015; 14: 491-502
        • Coppa G.V.
        • Gabrielli O.
        • Pierani P.
        • Catassi C.
        • Carlucci A.
        • Giorgi P.
        Changes in carbohydrate composition in human milk over 4 months of lactation.
        Pediatrics. 1993; 91: 637-641
        • Frese S.A.
        • Mills D.A.
        Should infants cry over spilled milk? Fecal glycomics as an indicator of a healthy infant gut microbiome.
        J.Pediatric Gastroenterol. Nutrition. 2015; 60: 695