Table II Primers used for real time PCR
GenePrimer sequences
ALDOACCCCAAGTTATCAAATCC, GAAGTCAGCTCCGTCCT
GAPDHATGTTCGTCATGGGTGTGAA, GTCTTCTGGGTGGCAGTGAT
ENO1CAGGTCTGGGAAGTATGA, GCGATCCTCTTTGGGT
Pyruvate kinase isozymes M2 isoform 1 (PKM2a)TGGAGAAACAGCCAAAG, GGCGGAGTTCCTCAAAT
Pyruvate kinase isozymes M2 isoform 2 (PKM2b)GTGCGAGCCTCAAGTCA, ACGTGGGCGGTATCTGG
LDHATGAATGTTGCTGGTGTC, GTAGCCTTTGAGTTTGAT
LDHBCTAGATTTCGCTACCTTAT, TCATTGTCAGTTCCCATT
PDHBGTGATAAATATGCGTACCATTAGACC, CAGCACCAGTGACACGAACAGC
ACO2CCACCACTTCCGTGTTCC, CACCTTGCCCACTTCTGC
FHGTGAACTAAAGGTGCCAAAT, CATACCACGAGAGGAAAATG
MDHGCTCGAAAACTATCCAGTG, TAGGGAGACCTTCAACAAA
UQCRC1GGGAGATGCAGGAGAATGAT, TCTGGGCGAGGTCTAACAGT
IDH1GAAGAAGGTGGTGGTGTTGCC, CTGGGACTTGTACTGCTTGTCATAT
Polymerase (RNA) II (DNA-directed) polypeptide A (POLR2A)GCAGGACGTAATAGAGG, CGGACACGACCATAGA