Table I Species recovered from (Genbank accession numbers)
Toxin typeSpecies recovered from (Genbank accession numbers)
3FTxAspidites melanocephalus (JX467122, JX467123), Cylindrophis ruffus (JX467124, JX467170)
CRiSPChameleo calyptratus (JX467127), Chlamydosaurus kingii (JX467128), Cylindrophis ruffus (JX467129), Iguana iguana (JX467125, JX467126) + Anolis genome (G1KVU3, G1KE85)
CrotamineUromastyx aegyptica (JX467130), Varanus glauerti (JX467131, JX467132, JX467133, JX467134), Varanus tristis (JX467135)
CVFAnolis equestris (JX467140), Boa constrictor (JX467146, JX467147, JX467148), Chameleo calyptratus (JX467136, JX467137), Chlamydosaurus kingii (JX467138), Cylindrophis ruffus (JX467143, JX467144, JX467145), Iguana iguana (JX467139), Physignathus lesueurii (JX467142), Uromastyx aegyptica (JX467141)
CystatinChameleo calyptratus (JX467152), Iguana iguana (JX467149, JX467150, JX467151), Physignathus lesueurii (JX467153)
ESPCylindrophis ruffus (JX467154)
KunitzChameleo calyptratus (JX467155, JX467156), Heloderma suspectum (JX467158), Iguana iguana (JX467157) + Anolis genome (H9G8B3, H9GRC6, H9GQ81)
LAOP. lesueurii fragment too small for database curation:
atgaaaagggacrgtctcctgatgaactctatgttggggaccttggacaaggtgacaaaaaactgcacaattttgaaggagaaatatgactcctattccaccaaggaatacttaattaaagaaggacatttgagcagaggagcagta
LectinAspidites melanocephalus (JX467159), Boa constrictor (JX467160), Chameleo calyptratus (JX467164), Cylindrophis ruffus (JX467161, JX467162), Morelia spilota mcdowelli (JX467163)
RAPBoa constrictor (JX467165) + Anolis genome (G1KIV8, G1KH55)
VeficolinChlamydosaurus kingii (JX467166), Cylindrophis ruffus (JX467168), Morelia spilota mcdowelli (JX467167)
VesprynBoa constrictor (JX467169) + Anolis genome (G1KXL5)
Novel peptideAspidites melanocephalus (JX467494), Cylindrophis rufus (JX467494)