Table I Primers used in this study
GeneForward primers (5′- … -3′)Reverse primers (5′- … -3′)Amplicon size (bp)
PLK1TTCCCAAGCACATCAACCCAGCTGGGAGCGATTGAAAACC182
PLK2TTCCTGCAGGGTTTCACTCCGCTGCTGGGTTATCGACACT232
PLK3GTGGCCACAGTGGTAGAGTCGCACCGTCTTCCTATTGGCT235
β-actinCCGTAAAGACCTCTATGCCCTCAGTAACAGTCCGCCTA278