Table I CRISPR/Cas9 constructs and PCR primers

DNA oligos and ssODN Cluap1 constructs were purchased from Integrated DNA Technology (IDT) and Eurofins. For Gateway® cloning of Strep/FLAG-tagged constructs, primers with Gateway®-specific homology arms were used (small letters). The repair (HDR) constructs are shown with FLAG-sequence for tag insertion (bold letters), and exchanged bases (underlined) to avoid sgRNA targeting to the repair construct.

Primer positionForward 5′–3′Reverse 5′–3′
5′UTR/intron 1GGAAGCTTGCAGCCCTCATAGGGCCAGTGGCAGATAGAGAAC
intron 5/intron 6TTGCATCAGAGATCCACATGGCTTTCATTTCCCCACTAACACATCCC
intron11/3′UTRGACAAGATGTCAGGAATGAGGCATGCAAACATAGGAGGCTAAAGCAG
Gateway cloning Cluap isoform 1aaaaagcaggcttcTCTTTCCGCGACCTCCGCaagaaagctgggtgttaTCAGAAGTCATTGTCACTCTC
Gateway cloning Cluap CRA_aaaaaagcaggcttcTCTTTCCGCGACCTCCGCaagaaagctgggtgttaTCAGCCACTCCCATCTATG
sgRNAsgRNA TopsgRNA Bottom
Exon1 sgRNACACCGCTGCCTTACTGCGGAGGTCGAAACCGACCTCCGCAGTAAGGCAGC
Exon 6 sgRNACACCGCTCGTTTATTTCCAGAGGTCAAACGACCTCTGGAAATAAACGAGC
Exon 12 sgRNACACCGTCATTGTCACTCTCATCCAGAAACCTGGATGAGAGTGACAATGAC
HDR construct FLAG N-termGCGAGCAGTTGCGACCCTGGGCTCCTGGGGACCTGAGCGTTATGGATTATAAAGATGATGATGATAAATCTTTTCGCGACCTTCGCAGTAAGGCAGCCCCGCGCCCCTGTGACCTGCGGG
HDR construct FLAG C-termTCGAAGGGTCCGGAAATCTGAACCCCTTGATGAAAGTGACAATGACTTCGATTATAAAGATGATGATGATAAATGACCCTTTTGCCAAGGGACCCTGGCAGATTAAAACCCTCAGACTTG