Table I

Oligonucleotides used in this study

Mismatch nucleotides are in lowercase.

NameSequence
Oligonucleotides complementary to U1A binding site
1.20a TTGTCCGGAGTGCAATGGAC
1.17 GTCCGGAGTGCAATGGA
1.15 GTCCGGAGTGCAATG
Oligonucleotides complementary to regions distant from U1A binding site
2.20 AAGGACAAGCGTGTCTTCAT
2.17 GGACAAGCGTGTCTTCA
2.15 GGACAAGCGTGTCTT
3.17 TCAGAGTTGACTTCACT
3.15 TCAGAGTTGACTTCA
Mismatch oligonucleotides
2C.20b AAGGACAAcCGTGTCTTCAT
2C.17 GGACAAcCGTGTCTTCA
2C.15 GGACAAcCGTGTCTT
3C.17 TCAGAcTTGACTTCACT
3C.15 TCAGAcTTGACTTCACT
U1 snRNA oligonucleotides
4.17 CCCTGCCAGGTAAGTAT
4G.17 CCCTGCgAGGTAAGTAT
  • a The first number indicates the sequence that is being targeted, while the second number indicates the oligonucleotide length, e.g. 1.20 is an oligonucleotide complementary to region 1 with 20 nucleotides.

  • b The letter indicates a point mutation in the oligonucleotide disrupting hybridization to the RNA.