Table I

Oligonucleotides used for gene expression analysis (RT-PCR)

OligonucleotideNucleotide sequence (5′ → 3′)
xfp Primer 1CTGGCCTGAACTTCCTCATCGGa
xfp Primer 2AGCGGTAGCGGCGGTAGCa
16 S rDNA Primer 1TCCAGTTGATCGCATGGTCb
16 S rDNA Primer 2GGGAAGCCGTATCTCTACGAb
BL0033 Primer 1AGGTGGCAGCTCGGACTCC
BL0033 Primer 2GCGGCGTCGAAGGTCTTGG
BL0034 Primer 1GTGGACGGCAAGCCTCAGC
BL0034 Primer 2TGCCTCCTTTCCGGTGTTTACG
frk Primer 1GCTCGGCGACGAACTGATTGC
frk Primer 2AGGATGCGGGCGGTGAAGG
BL1340 Primer 1GGTCGTCTCATCAACGGCTTCC
BL1340 Primer 2GGCGGACAGGGTGGATAGGC
BL1341 Primer 1GCGGGCATGTGGGCAATATCG
BL1341 Primer 2GGCAGGTCCAGCGTTTCAAGG
glkA Primer 1CTCACCTTCTCCGCCAACATCC
glkA Primer 2TCGCCGATCTTGCCGAATGC
tal Primer 1GACCTCATCGCCAACAAGAACG
tal Primer 2ACGTCAGACAGCACGGAATCC
  • a Primer specific to sequences for xfp of B. longum NCC2705.

  • b Primer specific to sequences within 16 S rDNA of B. longum and designed to produce a cDNA of 831 bp.